Description :
From Genome Similarity Track
Location :
contig_29:212168- 213990
Transcript NameFunction/comments
g6783.t1hypothetical protein

Sequence
1822 bases(100 bases per row)
GTACATCTTCTGCAGGATCGGATTCGCCACGCCCTCCAGCTCCTTCTGCTTCGACTCGTACTCCTCCTTCTCAGCAGACTGGTGTGCGTCGAGCCATTTG
ATCGTCTCGTCACCTTGTCGTCCACCACCTTCTTGTCGGCCTCCGGGATCTGCTCCTTCAGCTTCTCGTCGTTCAGGCTGTTGCGCAAACTGTACGCGTA
GTTCTCGAGCGCGTTCTTGGCCTCGATGCGCACCTTGTTGGCCTTGTCCTCCGACTTGTACTTCTCGGCCTCCGCCACCATGCGGTCGATATCGGACTGC
GACAGTCGGCCCTTGTCGTTCGTGATAGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGCCGACACGTTCAGGATCCCGTTCGCGTCGATGTCGA
ACGTCACATCAATCTGGGGAACACCACGAGGCATGGGCGGGATGGCGTCCAGGTTGAACTTGCCCAGAAGATGATTGTCACGGGTCATCGAGCGCTCGCC
CTCGAACACCTGGATGAGCACACCAGGTGGTTGTCCGCGTACGTCGAGAACGTCTGCGCCTTCTTGGTAGGCACCGTCGTGTTACGCGCGATCAGCGTCG
TCATGACACCGCCTGCCGTCTCCAGGCCCAGAGACAGCGGCGTCACGTCCAACAGAACAGGTCGCAGCTTGTCCGACGAGTCGTTGCCGCCCAGGATGGC
CGCCTGTACCGTGCGCCGTACGCTACGGCCTCGTCCGGGTTGATGGACTTGTTGGGCTCCTTGCCGTTGAAGACTCAGACAGCAGTTGCTGCACCTTCGG
GATACGCGTCGAGCCGCCCACTAGCACCACCTCGTTCACCTGGCTCTTGGACAGCTTGCGTCGCGCACACCTTCTCCACGGCTCCATGGTCTTTCGGATA
GTCGCCGCACAGGTCCTCGAAACGGGCGCGCGTGATGGTCGAGTTGAAGTCCACGCCGTCACAGCGAGTCGATTTCAATGTAGGCCTGGGCGACGACGAC
AGCGTCCGCTTGGCGCGCTCGCACGCCGTACGCAGACGCCGCAGCGCGCGTTGGTTCTGTGCCATGTCCTTGCGGTGTTTGCGCTTGAACTCCTGCACGA
AGAACTCGACGAGGCGGTTGTCGAAGTCCTCGCCGCCCAGGTGCGTGTCGCCAGCGGTGGCCTTCACCTCGAAGATGCCCTCCTCAATGGACAGCAGCGA
CACATCGAAGGTGCCGCCGCCCAGGTCGAAGATCAGCACGTTGCGCTCGCCGCCCTTCTTGTCCAGGCCGTACGCAATAGCGGCGGCCGTGGGCTCGTTG
ATGATACGCAGCACGTTCAGCCCGGCGATGGCACCGGCGTCCTTGGTGGCCTGGCGCTGCGAGTCGTTGAAGTAGGCCGGTACCGTGATGACGGCGTTCT
TGACCTCCTTGCCGATGAAGGCCTCGGCCACCTCGCGCATCTTGATAAGCACCATGGACGAGATCTCCTCGGGTTGGAACGTCTTGGACTCGCCCTTGAA
CTGCACCGTGATCTGCGGCTTGTCGCCGGCGCCCGACGTCAGCTTGAACGGCCAGTGCTTGATGTCGGCCTGCACGATCGGGTCCGAGAACTTGCGGCCG
ATAAGGCGCTTGGCGTCGAACACCGTGTTGTGCGCGTTCATGGCCACCGGTTCTTGGCGGCATCACCGATCAGGCGCTCCGTGTCCGTGAAGGCCACGTA
GGACGGCGTGGTGCGGTTGCCCTGGTCGTTGGCGATGATCTCCACGCGGTCGTTCTGCCACACGCCCACGCACGAGTAGGTCGTGCCGAGGTCGATGCCG
ACCGAGTATCCAGACGTCTTCG