Description :
From Genome Similarity Track
Location :
scaffold_29:212168- 213959
Transcript NameFunction/comments
g8912.t1 hypothetical protein PHYSODRAFT_344705

Sequence
1791 bases(100 bases per row)
ACGCCCTCCAGCTCCTTCTGCTTGCCCTCGTACTCCTCCTTCTCAGCGGACTGGTTGGCGTCGAGCCAGTTGATGGTCTCGGTCACCTTGTCTTCGATGG
CCTTCTTGTCATCCTCCGAGATCTGGTCCTTCAGCTTCTCGTCGTTGAGCGTGTTACGCAGGTTGTACGCGTAGTTCTCGAGCGCGTTCTTGGCCTCGAT
GCGCACCTTGTTGGCCTCGTCCTCCGACTTGTACTTCTCGGCCTCGGAAACCATGCGGTCAATGTCGGCCTGGGACAGACGACCCTTGTCGTTCGTGATA
GTGATCTTGTTCTCCTTGCCCGTCGACTTCTCAACAGCCGACACGTTCAGGATTCCGTTCGCGTCGATGTCGAACGTCACATCAATCTGGGGAACACCAC
GAGGCATGGGCGGGATGCCGTCCAGGTTGAACTTGCCCAGCAGGTTGTTGTCACGGGTCATCGAGCGCTCGCCCTCGAACACCTGAATGAGCACACCAGG
CTGGTTGTCCGCGTACGTCGAGAACGTCTGCGACTTCTTGGTGGGCACCGTCGTGTTACGCGCGATCAGCGTCGTCATGACGCCACCGGCCGTCTCCAAA
CCCAGAGACAGAGGAGTCACATCGAGCAGCAACAGGTCCTGCAGCTTCTCCGAAGAGTCGTTGCCACTCAGGATGGCAGCCTGGACGGTGGCACCGTAGG
CCACAGCCTCGTCCGGGTTGATGGACTTGTTGGGCTCCTTGCCGTTGAAGAAGTCGGACAGAAGCTGCTGCACCTTCGGGATACGCGTCGAGCCACCGAC
AAGGACAACCTCGTGCACCTGGCTCTTGGACAGCTTGGCGTCGCGCAACACCTTCTCCACGGGCTCCATGGTCTTACGGAAGTAGTCACCGCACATGTCC
TCGAAACGAGCACGCGTGATGGTCGAGTTAAAGTCAATGCCATCGAACAGAGAGTCAATCTCAATGTAGGCCTGAGCCGACGATGAAAGCGTACGCTTGG
CGCGCTCGCACGCCGTACGCAGACGACGGAGGGCACGCTGGTTGTCCGTGATGTCCTTGCGGTGCTTGCGCTTGAACTCCTGAGTGAAGTGGTCCACCAG
ACGGTTGTCGAAGTCCTCGCCGCCCAGGTGCGTGTCGCCAGCGGTGGCCTTCACCTCGAAGATGCCCTCCTCAATGGACAGCAGCGACACATCGAAGGTG
CCGCCGCCCAGGTCGAAGATCAGCACGTTGCGCTCGCCGCCCTTCTTGTCCAGGCCGTACGCAATAGCGGCGGCCGTGGGCTCGTTGATGATACGCAGCA
CGTTCAGCCCGGCGATGGCACCGGCGTCCTTGGTGGCCTGGCGCTGCGAGTCGTTGAAGTAGGCCGGTACCGTGATGACGGCGTTCTTGACCTCCTTGCC
GATGAAGGCCTCGGCCACCTCGCGCATCTTGATAAGCACCATGGACGAGATCTCCTCGGGTTGGAACGTCTTGGACTCGCCCTTGAACTGCACCGTGATC
TGCGGCTTGTCGCCGGCGCCCGACGTCAGCTTGAACGGCCAGTGCTTGATGTCGGCCTGCACGATCGGGTCCGAGAACTTGCGGCCGATAAGGCGCTTGG
CGTCGAACACCGTGTTGTGCGCGTTCATGGCCACCTGGTTCTTGGCGGCATCACCGATCAGGCGCTCCGTGTCCGTGAAGGCCACGTAGGACGGCGTGGT
GCGGTTGCCCTGGTCGTTGGCGATGATCTCCACGCGGTCGTTCTGCCACACGCCCACGCACGAGTAGGTCGTGCCGAGGTCGATGCCGACC