Description :
From Genome Similarity Track
Location :
Scaffold_5:2121673- 2129660
Transcript NameFunction/comments
Phyin_T30-4PITG_04200NPP1-like protein

Sequence
7987 bases(100 bases per row)
AATACAAGGACGAGCTGAAGAACGCCTTTAAGATGAAGAAACCTGGCGAGGCCAAGGTCATTCTCGGTACGGCGATCAGTTACAATATTCCAAATGGAAC
GCTCATGATCAAGCAGACAAGATGCATTGACGACGTTGTGGAACGCTTCAATCAGCGTAGCGCCAAGGTGGTGGAAAACCCATGCCCGTCAAATGTGAAG
CTATCGACGGCTATGTCGCCGACGATCGAGTTGGAACGCTCCGAGATGGAGTTGGAACGCTTCAAGATGCTGTCGCAGCCGTATCGCTCCTTGCTCGTGT
GTCTGGTGTACATGGCTCTGAGCCTGTGCACGAAAGAGGTGCTATGGCCACGACGGATGCACAAGGAAACGGGTCAAGAGCAAGTGGGAGCGATGCAGAT
TTGGAAGGACGCCATTACACTGGAGAGGAACACTAGATATCACGCAAGGGCCAAGCATGTCGACATCCGTGAGAACGTGGAACGTGGAACGGTCAAGGTC
GACTATATCGACACGAAGTTCCAACTGGCCGACATGCTGACGAAGGCACTTGGGATGAAGACCCTGGCGTTCCAGCGCGATGCGACCGGCATTAAGAACA
AGGCTACCGTGGAGTAGTGGTGAGTGGGAGTGTTGCAGCTGCACCGGCTCTGCACGGTTAGGCGTGACCGTTGGAGCGGTTACCGAACCGTTCCACTATT
GGCTGGAACTTTTTCTGGAATGACATTGGGTAATCACATGTTAGAGCGCTATGATTGGATGAAGGCACATGGCATTAGTGATTACGCCACACTTACGAGA
AGACAACAAGAGGAACGCCGCTGAGTAGCGATCCTTAGCGAAGACGAACGCCGTGCAGTAGCGGTGAGTGGGAGTGTTAGTTCACACCGACTCTGCACGG
TTCAGTTCACCGGCTGAACGTTCCAGGATGGACCGTTCCCAAACCGGTTAATCTGGTGGATGGCAAGGAGCGCTTGACAAGAGGACAACAAGGAGGACAA
CGCTAGAGTAGAAGTTTAGAGGACAGATTTAATTGACTTTAATCTACTTACTTCGGCATTTACCGCTTACAACAACAACAGTGTCACAGTGAAATACTAA
AGCAAATACTCGTCAGTTTTAAAGCCTGCCATCACTACTGCTTCATTGAAAGCTGACCGAAAGAATTATTTCGTGGGCACTGGTTCACTCAGCAAGGTGG
CAAGAAACGTACTTAAGTAAACAAATATCATAAATTTTATCTAGCATCTAATATTTTCATATTTCCAAGTTAATGTTAAATTAATATGTTTTAGTTTTAA
GACAATGAGTTTTTATTGGCATTTAATATCTAAAATAGTACTATTACGATTTTAAATATCATATGATATTTGGATCCTTCTTTTTTAGCAGATTACGTGA
TACAAACAAGCATGACTATTCATAAGTACAACACCTGGTTTATTTAGATGGTGACCAAAGTCAGACGGCTACTAACACCCCGATCCCAGCAAAATGATCG
AAGTAAGTTTTCCTGTTTACGAATAGTTTGCCATCCCCGGAAATCCCAGAAGATTAAGAATGAGAGTTAGGTGTCTCCATGGCAGTGTTGTGCTTTGCCA
AGAACGATGATTTCAATCATCAATTTTCAGCTTCGGACACATGTCTTTACCGGTTCATTCTCTATGCACTATGACCCTGATGTCATTCTCCTTTGCCATC
ATCGCGGCGCTGGTCGTCGTGCATGCAGAAGTCACTTACATCAACCATGACGAAGTCAAACCGTTCGCCCAGCCCACACCTACGACTGACTCGGAGAAGG
CCGCTGTCAAATACAAGCCGAAACTCTACGTCTCCTACGGCTGTCACCCGTATCCCGCCGTGCAGGCCAATGGATTTGTAAGTGCTGGACTTAAAGGGAG
TGGACCGATAGATGGCGAGTGCGAGGGCTCATCTCTGGGCTCTCAAGTGTATTCTCGTTCGATGTGGTACGAGGACAAGTGGGCTATCATGTATGCCTGG
TACCTCCCAAAAGGACGAAGCTCCAAGTATCAACGTCGTCATTTCTGGGAAGCCGCTGTTGTCTGGATCGATGATCCTGCTCTCGCCAATTCGACGATTC
TCGGTGTGTCATTGAATTATGGCCGACGCCAAAAATCCGAAGTCCCTCTGGAGCTGCAATTCCTTGATGGTTCAAATGTGAAGCTTGAATCATACAGGGG
ATTTGGAAGACCAAGGCCGAGGCTGCAGTTCACGCAGCTCGAAGGGGAGACCCAGGACCTCATCACGTGGGAACAGCTCACTGATGAAGCACGCGATGGC
TTGAGCGATGCCGAATTCAACACCGGACTGTTTTTTAAGAGAACGAGGAGAGAGATGCCACTAAAAGACGGTGTTTTCGAGAAGAGACTGATAGATGCTT
ATCCGTTTGAATAGTTACAACTATGGGGGTGGGGGCGCTTTATACCGTAGACCCGGTAGCCAAATTCCAATACAAAAACAAACTGAAACCTCTCGAACAG
CTCGATGCAGCGCGAGTTTTAGTGTGCCTTTTTCTAACGTTGCTGGCCCTACCGGTAAGTAGGGTTAAATCTTTTATGATGGTAAAAATGTAATCAATGG
CGGCTGCGAATCCTACCTACGGCTCGCACGTAAGGGGCCGTTCAACGTGCTCCACTGCAATGCAGCCCACTTTGTGTGTGTGTTTTTAAAGCCAATGTTT
GGCTTACTATTCGTTTAATACATTAAACATTATTTTTTGTATAAATGCGGCAAAGGAGGTACCAAGCATTTATGATGGCCCACTTATCCTCGTACCACAT
CGAACGAGAATACACTTGAGAGCCCAGAGATGAGCCCTCGCACTCGCCATCTATCGGTCCACTCCCTTTAAGTCCAGCACTTACAAATCCATTGGCCTGC
ACGGCGGGATACGGGTGACAGCCGTAGGAGACGTAGAGCTTCGGCTTGTATTTGACAGCGGCCTTCTCCGAGTCAGTCGTAGGTGTGGGCTGGGCGAACG
GTTTGACTTCGTCATGGTTGATGTAAGTGACTTCTGCATGCACGACGACCAGCGCCGCGATGATGGCAAAGGAGAATGACATCAGGGTCATAGTGCATAG
AGAATGAACCGGTAAAGACATGTGTCGGAAGCTGAAAATTGATGATTGAATTCATCGCTCATCGCAAAAGTCCGTAAACAGGAAAACTTACCCGATTATT
TTGCTGGGATCGGGGTGTTAGTAATGGGCCCCATCCGCCTGACTTTGGTCGCCATCTAATTACTGTACATGTAGACCAGGTGAGCTTTTTGTTTGCGTTT
TTTTGTGCTGAATCACGCTTGTATCACGTACTTCGCTAAAACGAGTATGTGATTACAGTCTGTAGCTTTATCGTGACTAAACAGAAGACACCACAAATAG
TTTTTAAGCTGGCCGTCGCAAGAAAAATATGCATGTAGCGAAAACGACTTATACTACACAACTGACGCTGTAAAGACTGATGAGCGATAGAATTGCCTTG
GAAAGCTCAGCACAAGATTTGCAGACAACTAGGACAATTCAACTTACTGTACTTGTACGCTGTTACTGCACCATGGTTTTTTTAGCGATTTGTAAAATTA
TGGGATTTGTTCGATTTTAGCAGCATTTATAAATATTACCAGAACAGGGCTCACCTCAGGATGTATATCAATAGGGTACAGACAACGACGGTGAAATCCG
CCCGGTGTCTGAACACTATCCTTCATATAAATTAAAAAAATTACGCGCGATAAGAATACCCGCCCAGTTATTTGATTGGTTGAAAGTTGCAGTTTCAGGA
GCACAAAATACAAAAACGATTCCAAAATGTACAGAGCCGATGCAGGAATTAACACATCCTGGGTTGATTGTACAAAAACGCCAAATACGCGGATTGGCTG
AAACTGGTTTCATTAGTGGGAAAACCATGTTTGGACTCGGGCGTGTTTCAAAGAATATGATTGAATAAAATACAAGGTGAACGTATTTGGATACACGCAT
CTCGAAAACGTCCACACCCAACGAGGATGGCAGCGCTCGGAACTCTAAGCAAACTCGATCTCCTCTCTCGCTATGGACATGAAGGTCATAAGATGCTAAT
TCACCTCTCCAATTTGGAACTTGTTGGGCCGTTCATTAGAGACTACACTTTCAACATGAATAAAAGTATAAAGCACAACAAGGAAGGCGGGAATCATAAT
AAGTGACTGTGTTCTAAACATGGAAGCGGATGGCCGTGGTTTATTTTGCTATCTAGTAAACGAGAATCAACTGTCGCAGATGGCACTGACAATCGAAAAA
CCCCAAAGACGAAGCTATCATGATAGCTCGTGGTACATCTCGAAGTTGGACCTACAACACTCCCAGTTTTGTAGTAGTGCTGCAATAACGACAAGCGAAT
ACTTAAAGGAGCAAGCTGGTTTTAGCGCAGCCTTAGTGGATGGACATATCACTTCAATGGCGCCTGTCGTCAATAACATAAAGGCATTTCATGGATTCGA
TATACAGCAGTAACCAGCACTTGTTTATTGTTCAATTTAAAAGGATAAGAAAAAGAAATAATTGATCGTTTGCCTAGCTTCTTGAAGGATTTTTCAGGAA
AAATCTAATCATTCCGCGTCTGATGCCAAGTAGATTCGAAAGGGGGGTTATTTCGTGCGTTTGTAGCTATCGGTACTGTTGTTCGAGCTCAAGACAGCGT
TTCACCGGTGTGGGTGTGACGGGGTCACACAGCACCTTGCGCAAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTC
CCCTCTTTTATTAAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGATAAGCTCGGGTTTAATACAAACTATTAG
TTACCTATAGAAATGCAATGTCATTTAACCAATGGTTGGCTTTGAACGACTTTGGTACCTTGTACTAAATATCCCGGAGTATGACGTGTCATACTCCTGA
AGTGTGAAGTGTCACACTTCATGTAGCCAGGGTACACTTAGGGCTACGTACCCCGTTACATCCTCCTCCACTTAGGTCCGGTTTACCGACCAATCAGAAT
GAAGAGGTGTTCGTCACAAACTCTCATTCTCAAAGTCGAAATCCATCGACTTGGCCGCGCGAGCGCGGCGGAGGCTCACTTCACAGTTAGAGCTTTGAGC
AGCAACCTGTGCGCTCTTCGTCTAGGTCTCCAATTCGACCGTTAACATGCCTCGTGGCACTACTAAGAGCGGTGCTAAGACACGCTCCAAGGCTGGAGCC
GGTAAGGCGCAGGCCAAGAGCACTAAGCCTCACGGCAAAGGCTCTGCACTCAAGGAGGCTACTCAGGTCGGTTCCTCGGGTGACGCGGCTGCGGACAAGC
GCGCAAGCAGGCGCCGCAGTCCGTCGCCCTCGTCTTCAGACAACCGTCCGAACCCTCGGTTCGTAGAACGCGAGTTCAACTCGGGCAGTGAAGACGATGC
CGAGTCCGAGAGCACTCAGGATGCTCCTGCGGGCTCTGTGGGAGGGCACAGCCCATTGCCCAGTGAGCACAAAGATGACAGCGTGCAGTCGCCCGCTAGT
GATCACGGTGATCACAGTCCCAGGACCTCTGTGCACTCTGAGAGTCCGGCCGTTAAGGCTAAGGGCGCTCCCAAAGCCGGTGGAAGAGAATCCTCGCAAA
CGTCTCTCGCTTGCCGAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACCGCCTCTAAGTCTCCACTCCGCG
AGGAGAAGGAGACTCGACGCTCCTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGAAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGGTTCCATTGTTGA
GCCCCGGAAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGGCGGCACCCGTCAGCAAGGGA
GCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGATCTCTGGGGCTGACCTCTTCTTACAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGTGGCC
ATACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACTTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCAACACCG
CATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTCTTTGGGGATACCCCTGGGTTATGTTCGAGAACTGT
CCCACCTGGAGCTGCTGTGAGGACATGCTTTGGGCATAGGTGGAGTCTCTTAAGTACTCACCCACGGAGTTACGGGAACTCCATGAAGATCAGCAGCTGT
CCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCGC
TCACGATGAGCGCGGGTACGGTATGTATTCATCGACCGTACCCCGTTCGGGCAAGAAGCCCCGGGCTACTTATGAAGCTGCCGCCGCTTCTGTTCCCAGA
TTGCGACAGCCTTCAAGCAGTCAAACAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTT
GCCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGGCTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTA
CTCGGCGCCTCCCGAGAGCCACTCTCGTCCGAGTGCTCCGACTGCGGGTCCGACACAGGACCCTGAGGTTGACCGCCTCCGTCAACGTGTCCTCGTGCTT
GAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGCCGCCTGGACCTGGTGGAGC
GAGAGGTCGCGAGCCTGCACCTGCGAATGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGCTGCC
ACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTAT
GGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGACTTGGGTGCCTGCTCCGACGCCCTCGTCGACGACTGTGACCGGCCCTC
GCTTCGAGGAGCTGGGTCAAGGGGGATCTGCGAGTCAGAAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTC
ATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGC
TAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAACCTCAAATATACTTAAGTTTCCTCTTCCTTGTTTGTTTGAGTACTCCTT
TTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTAATATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGC
CTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCCCCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGG
TGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGCTGAGCGCAAACTCAACAACTAGAAGCTGCGACGACCACGTAC
GTGACGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCCACTGTCTGCGGATGATCCG