Description :
From Genome Similarity Track
Location :
Scaffold_27:212150- 214105
Sequence
1955 bases(100 bases per row)
TCTCGTAGCTCGTACAACACAGATGCGTGAACTACAAATCTTCAATAAAGCGACTGTAGTATTTCATACTACCCAGGAACGATTGCATGAAACGCAACGT
TGTGGGGAAGGGGAAGTTAACCAGCGATCCTATATCCTTAGGATTATCTCCCAACCCGGCCAATGATACCTGATGACCCAGGTAATCCACCTTACGCCGT
CCGCAAAACCTCTTGGTCAAGCTGATCGACAAATTCCATCGATCGCATACCGTCAGTAGTCGCTCTACCTTGTTATACAGGGAAGTCCACGACATAGCTG
GGATAAATCATCAATATAAGATCGTCTGCCCAGCACTGACGGCGTCTGGTCGGTTTCTGGTTCTCCTTCAGTGAACACATCGGTCAACCTAAAGGAATCT
GTTGTGGTCGCATCCTTACCCCCGCCGATCTTGAGATATCCATCTAAAGCGTTATCAATCAAACGCTGATAAATCCGTGGAGCGTTCTTCAGTCCAAAAG
GCATCCTCAACCATTCAAACAAATCCGACGGTGCGATAAACGCAAAGTGGGTCACGTGCAATCTGACTGTCGGTCGAAGGGTAAAAGAAGAAGCGGAAGT
CCGAAGGACGACAGCGCAGATGGCGGTATGGTGCTCGCACTACGCAAAACGAAAATGAAGGAGCGATCGAAGAAACCGAAGCGCAGCAGGTAGATCAAGC
GGGGGATTGTACTTGCAGTGAACGACTCGGATGGCTGCGATGGAAGCGACTGGATACTCGACAGCGACGCAAGTCGATATCTTGTGAACGACGAGAAGCT
GCTTAACGACTCGACTTCCTGCAGCCGAGAGATCGCTATGGCTGATGGAAAGACCCTGCACCTGATGCGAGTCGGCAGAGTGCGTCTAGAAGTCATAGAT
CGCGGCGTGGAGAGCATCGTGACGCTTACGGATGTGTATCTGGCACCGAGACTGGAGAAAAACATCGTCTCGTACGGCAAGCTGGAAAGTAAGGGATTTG
CTCTTACTTACGATAAGAAGTGGCACGCGTTCGCTCGGCGCAGCGACGGAGCCGTCGCGTTCGACGTTGTGATGAAAAGCAACGTTTTATACGTAAAGGT
GTCAGCAAAAAAGGGGAGGCAGAGAGCAGGCGACACCATCATGGCTGCTCTCGAATTAGCTGCGAGCGCAGATGTTGCGAGCGATGTGCAAGAAGGCACG
CTGTTACACTTTCATCAGAGATTTGGGCATCTGGCGTTTGACACCATCGAGCGTATGGCTCGGGACCCAGCCTCCGGTATAAGACTAACGAGCAATAAGT
GTATGGCGTGTGTCTCATGCATGGAGGGTACGCAGACGCGCAACATCCAAAACCAGGAGGACAGTGGCACCAACGCACCTATCGATAGAGTCGGCGGAGT
CATCTGTTTGGATTTGAAAGGTCCGATGACGCCGCGGGATAGGCTCGGAAACCGATATTTGGTTAATTTTGTCGAACACAAATCGAATTACAGCCGAATC
TTTCTTGCGCGGACGAAGGACGTAGCGGCTAAGCAGTTCGAGGCCTTCCTCGTCTTCTTCGAGAAGCGATTCAACTGCCGGATTCTCGTGCTGAGGACTG
ACGGCGGTGCAGAGTACGCCAACGTCGACCACTTTTGCAAGAAGACTGGGGTAACAAGGCAAGTGTCAGAAGCAGGAAATCAGGCTTCCAATGGCAAGGC
AGAGGGCATGCACAGGACGGTGCTAAATTTGGCGTGGAGCATGATGTTTGCGTGCGGACTACCACTACACTTCTGGGGAGCATGCGTAGCAGATGCGCGT
GTCTCTTCGCTTCGAGTCGACATGAGCAGAGATGACTTCGCGTCCAATTACCCCGCTGCCGAGCTCGATCGACTGGGCAAAGTGCGCCAGCTCTTCTGCA
TGTCGTAGGTAGTCGACACGCGTCGAGTCGTACTTGGCCTGCATGACGTTCATCA