Description :
From Genome Similarity Track
Location :
scaffold_313:21215- 23503
Transcript NameFunction/comments
g7147.t1 myosin-like protein

Sequence
2288 bases(100 bases per row)
AACCTCAAGAAGCGCTTCCGAGCTCGGATGCCGTATACTTACACGGGTGATATCTGTTTGGCGGTGAATCCGTATCAATGGCTGGACGAACTGTATACGC
CCGGCCACCACAAGAACTACTTGCAAGCGCGAAAGCGACAGGATCTACCGCCTCATGTATACGCCGTATCGGTGGCTGCATTCAGGCATATGTGTGAGAA
TGCTAGCAACCAGAGTATCCTCGTTAGTGGAGAGTCTGGTGCAGGAAAGACGGAGACTACGAAAATTCTTATGGACAACCTGGCGACGATCGCACCGGCA
CCTGCCGCTGCTAGTGAGCAGGAAAACACTATTACGACGCGTATTATCGAGGTAAACCCACTGCTGGAGAGCTTCGGCAACGCCAAAACCACACGCAACG
ACAACTCCAGTCGCTTCGGCAAGTTCACGCAGCTCCAGTTCGACAAGAACCACGCTCTCTGCGGCGCTCAGTGCGAGACTTATCTACTAGAGAAGACGCG
TGTGATCTCTCATGAACGTGGGGAGCGCAACTACCACATTTTCTATCAACTTCTGCACGGCACTACGGACGAAGAGCGGGACGCGTTGGGTCTTGGAAAC
GAAGCCCCAAAGTTCGTTTACTTGGAGGAAAAGGAGCCCCAGGAGGAGGATCGGCCAGGACGGAAGAAGAAGCTCAGTCAGCCGCCACCACCGAAGTCTG
AGGCTGTTATTGAAGCTGAGAACGCGAAAGACCGAGCACTATTCGCCAAGACACGACAGGCGCTTTCACTTTTGGGTCTTGACTCGGAGCAGCAGAACGA
CCTGTTCCAGGTCTTGTCGGGTATTCTTCACTTGGGTGAAGCTCAATTCACTGTAAAGCCGGACAACGATGAAGCTTGTGATCTGGGCAAGGACTCGGTG
GTTTATTCCAGCACATTGCTAGGCTTGAACCCGGACACGATGTCGAAAGCGCTTACGCACCGGACTATGAAAGCTGCTGGAGAGGTTTACCTGGTGCCGT
TGACTGTGGAGCAGGCGCAGTCTGGACGTGATGCGCTGGCTAAGGCTATCTACGCTAGCATCTTCGACTGGCTCGTGGCTGGTATCAACGCGAGTCTGGG
AGCTGCGCCACGGCTCACTAAGAACACTATCGGCGTGCTGGATATCTTCGGCTTCGAGAGCTTCGAGCACAACTCGTTCGAGCAGCTCTGTATCAACTAC
GCCAACGAGAAACTACAGCAAAAGTTCACCCAGGACGTGTTTAGGGCCGTGCAGGAGGAATATGAGCGCGAGCAGATCACGTGGGCCCACATCGCGTACG
CAGACAACAGTGAGACCCTGGCGTTGATTGAAGGACGTATGGGTGTCTTAGCTCTACTGAACGAGGAGATCGTGCGCCCTCGAGGCAACGAGGAAGGCTT
CGTCAGCAAGCTTTCGGGTGCTTACCTCAAGCAGAAGAAGCTCATTGAATTCCCACGTATCTCCAAGACGCAGTTCGCTATCCACCACTACGCTGGAACC
GTCAAATACGAGGCCGCTGGATTCTTGGAGAAGCACAAGGACGCTTTGCTCTCGGACTTGTCGGATTTAATGTGTGGCAGTCATGAGCCGTTCCCCCAAA
TGCTCTTCAAGGTCAAGGCCGAGATGGAAGCTGCCGCTGCAGCCGAGTTAAAGCGCTCGTCTTCCGGCAGTCGTAAAATGGGTGGCGCTGGAGGGGATAA
AACCGTGGGGATGCAGTTTAAGCAGTCTCTCAACGCTCTCATGACCAACATCAACGAGACGAACGTCAACTACATTCGGTGTATCAAACCCAACAGCGTA
AAAAGCGCTACACTCCTCGAGGACAAAATGGTCGCCAACCAACTGCGCTGTGCCGGTGTCATTGAGGCCATTTGCATCGCCCGTGCTGGTTACCCGAACC
GACTGCTTCATGCCGAGTTCGCTGAGCAGTTCGACATCTTTTTGAAGGAGAAGGAGCAGAACCAGCTTAAAGAAGACCCGGAGAAGTACGGCGCGCCGCA
CTGTCGTCTCTTGGTCAAGCAGTTCAAGCTCGAGATGCCCGAGGAGTATCAGATGGGCGTGACCAAGATCTACCTGCAGAAGGGTGTACTGGAGAAGCTG
GAGCACGCCAAGGCGCAGAAGCTCTTCGCCTACGTGGCTCTCATCCAGGCCCAGTGGCGCGGTATGCGCGCACGCTGCCAGTACTACGAGATGCGTGACG
CTTTGGTCGAGATTCAGCGGCGCGTGAAGGTTTTCGTGGACAGATGCCGCTTCCTTCGAGCGAGAATCGCCATCGCCACCATTCAGCG