Description :
From Genome Similarity Track
Location :
Scaffold_10:212112- 213325
Sequence
1213 bases(100 bases per row)
AAAAATGGTTTGACATCGGCGTGGCTATCGAATCCTACTTTCACATGGGCTTCAGAGTGCCTGACAGAAACACGTAGACCGTTGTGTATCATCGATGGGT
GCTGCAGGATGTGTTCGGTGAAAGAGTGCACGAGCCGCCTTGTCGATGACAGCGATCACAAAACGATATTGTATTATACTCGATATACATGCACATGTAA
GTTGAAGGGCAATACCTTCTTTACAGTTGACAACTTGTACATATCTTCAACCAAAACCACCCTTTTTGAATATTCTTACTTACTACCGTATAAGGATACG
CCATCGAAGGATATGTTTGATCCTGTGTATGACAGTATGTTGACCACTACATGGATATACGAGTCGATGGGCAGTATAATAAGGCGGAGACAAATGAGAT
GCAGCAAACCTCGTGCTGCTGTGGCTGTCGAGTATGAGCAGTCACAAAATCCCAGGTTTCAGCACCTCTGTTTGGCTCGATTGAAGGGTACATGGGATCT
AACGGCTGTATTGACGGAGAAACGCTTCGAGGGTTCTAGCTTTCTCAATGTGAGGTATGTTCCATGTTGCTGGAATCTCATATCGCTCAAGTAAGGTGCG
ATCGAGGGTACCGCTGCGATCACTCGCAAAGATTTGCAGTAAGTTGATGGTGTTCAGACCTGATGGTAAAAAATGACAGTCGATAAATGTATGTATGCTT
CATTTAGTGCAAGATGAAATAGATCAAATTGTTGCTAGGAGTTTGACACGTTCGAGGAATCACGATGAGCCGGCAGCGATTCTGAATTCGGTCGTGTCGA
CTATGGACACTAAAGCTTCCCCATATCATGTTTGTGTATGTGATGATGCTAACAAAACACGGCGAATGATAGAAAAGGGTTTGGCAGCGTCGTTGAAACG
AAACAAGATCCGTTTCACATCATCCAGCCGTTCATCGAGAAGTTGGTCGAGAAGTCTGAGCGAACAGCGTTGGCGAAGAAATTATCAATGACATTATTCG
ACGTAGGTGGAAACATCCGTAAGCCTGAAGCAATGGCAGAGCTATTTCAAGGCGTACTACACAAGGTAAAGCCCTTAAGCGTATGTGCTGACCATTTAAG
ATGGGTAATTGCATCACAGTTAATACGGAACAGATTCGGAAAGGGGATCTGCACGTGGAGGACAACGAGTACTTAGAAAAGAAATCGAAGATCTGCGTTG
CCTTAACAAGTCA