Description :
From Genome Similarity Track
Location :
Scaffold_113:21211- 22780
Transcript NameFunction/comments
Physo_142366hypothetical protein

Sequence
1569 bases(100 bases per row)
CATTTGGACGCGCAACGCACAAGCCAAGTGTCCACTACGCACCAACTCACTAACTCGCTAGACATGCCGCCGCACCCTGACGACGTCTACAACGAGGTCT
CCACGCCCAAGGCCGACGTCGCCTTCGACGATGCCAACAAGGCCGCCGCGCTCCAGATCAAGCCCAACCGCATCCTCTACACGAGCGTGCTGCTGGCGCT
GCTGCAGCCCTTCCAGAGCGGATGGTCCACCTCGCAGCTCAACCTGTCCGACTACAACAACACGGACGAGTGCAACGCGCGGCCCGTCGTCCCGGGCACA
TGCACGCTCTTCAGCGGCCACTCCAAGCTCGAGTGGACCTTCGCCGTGAACGCGTGGATCTTCGGCGCCATGTGCGGCAGTCTGCTCTGCGGCTACTTCA
GCGACATCATGGGCCGCAAGAAGCTGCTCTTCTTCAACTGCTTCTTCATGTGGTCGGCGGCGCCGTCATCCAGGCCGTCGTCTCCAACATCTGGCCCTTC
GCCGTCGGCCGCATGGTCTCCGGCATCGCCTCGGGCGCCGCCACCGGCACCATCGGCGCGTACGTGAACGAGCTGTCGCCGCCGCACCTGCGCAGCCACC
TCGGCCTGGGCCTGCAGATCTCCACCACCATCGGCATCTTGGTGCCGGCCATCTGCTTCTTCTTCGCCGACAGCGGCGATGGATGGCGCTACATGGCCGG
CTTCCCCATCGTGCTGGCCGCCATCTACATGTTGCTTTCGCCCTCGCTGGCCGTCGAGAGCCCCGCGTGGCTGCTCATGAAGAACCGCCGCGAGGAGGCC
AGGCAGGTCATCACGCGTCTGTACGGCGAGGAGCACGTGCAGACCGCGCTGGGCTGGCTCGAGGCCAACAAGCAGCCGAGCGAGGCCGAGGCCGGATACG
CCGCCAGCTCGCAGCCGGCCGAGTCGATCTGGTCGCCCAAGTACCGCCTGCAGTTCCTCGGCGCGCTCCTGCTGTCCTGCACGCAGCAGCTCTCGGGCAT
CAACGCCGTCTTCTACTACTCGGGCAACATCTTCTCGGACGCCGGTATCTCGGACTCGCGCGTCGGCACGCTCATCATCGACTTCATCAACATCTGGCCG
GCCTTCTTCACGGGCGTGCTGGCCACGCGCTTCGGCAACCGCAACATGATCCTCTGGGGCATCGCCGGCATGGTCGTCATGTCCATCGGCATGACCGTCG
CCTTCCTCGTCGACGTGTCGGCGCTCTCCATCGTCTTCACGGCGCTCTACGTCATCGTCTTCGGCGTCACGTCTGGGTCATGACGGCCGACATGTTCCCG
GACTCGGTGCGCGCCAGCGCCTCGTCCATCTGCATCGGCGCCAACTGGCTGTGCAACCTCATCGTCGGCGTGGGCTACCCGTACCTGGCCGACGCCTTCG
ACGACTGGAGCTACACGCCCTTCACGGTGCTGCTCATCATCTTCTACATCCTGTCGCTCAAGCTCGTGCCGGAGACGGCGGGAAAGACCAACGAGGAGAT
CCAGGCAGAGTACGAGGAGCGCCGTCGCCGCTAAGCAGTCGTCAGTGTCGGATAGTGTACTGTAGCGGG