Description :
From Genome Similarity Track
Location :
Scaffold_1144:2121- 3643
Sequence
1522 bases(100 bases per row)
TCAACTTTGTATATGCCTGCGTCATCGCTGACTTCCCAGCTGTCTTCAAAAAGCAATTATtagtcgaagtcgaagcgttGTGCTTcgttcacctcgtcca
ccaaCTTCGATGCAGGTCTCGTTTCCGGGTCAGCTACTGCTTTCAGCCGAGACACATCCACCACAGGATAGAACCGGTAACCACTCTTGTCAGGTAGTAC
GAGCTCGTATGCAAATTCTTcaaccttcttcttcaccggAATGGACCATGCCATCGGTGGGCCAGTAGCTTCGTCAAGCCAGGTGTCACCCTCTCCATGA
ACAGCCACACTTGGTCTCCTGCTTTGAACAACGATTGTTGTAGTCCAGCCGACTCGGCTGTCGCCTCATCTTCATCCCCAGCTGAGTCCATTGCGTCTTC
CACTGAGTTCTCTGTGTTTTCCGCCGAGTTCCTAGCGCTTGAAATAACTCTTTGTTCTCTCTTGCTGAGCTTAGCGTTATGTTCTCTCGCCCGCCGAGCT
TACTCCGTTAGCTGGTATTCTTTCGCTAGTTTGAGTGCGATTTCCCGTTGGCGATTTGCTTCCCGTCGCCATTGCGTGGCTTTCGCTGAGTTTGCAGGCT
CGTTCTTAATAGTCGACGTCATTGCCTTCAGGGTGGACTGAGCATCCCAGCCGTGCACAAGGTAAAATGGAGTCTCCCGCCGAGTTGTGTCTCATGAGTT
GTTGATAGCGTATACCATCTTCTCAGCGATACCATCCCAATCAGCTTGCAAGGGATCCTCGACATAAACTCGGACTGTCTGGATCATCGCCTTAACCGAA
CGCTCTTGCTGTCCATTTGCTTGGGGTCGATAACTCAGCGTTGCTCTGGATCTCGACGGTATCAACTCGGCGAATTCTTGGAAGACTTCGCTCATGAATC
GTGGGTCTCGATCGTGCCGGATCAGCGCTGGCGATCCGAACCGCTGGAAGACACATTCGTCGAACGCTTCAGCTACTCCCAGTGCACCAGTGTCACTCAT
CACCCTTGTGATCACGTATCCAGTGAAGTGGTCTTGAAAGAGAAGCAAAGCTGAGTTACCTCGCTGAGTTCTCGGTAGCGGAATAACAAAGTCCATTGAC
ACCATCCGGAATGGTCGGTCGGACACTACGTTTCCTGGCGAGAAACCTCGCAGTTGGGGTTTGCTTTTTCTCGTGCTACAGTTTTCGCACCTCTGGACAT
GCTTGACTACATCAGCGTACAAGCCAACCCAGTAGAACTCGGATTTCACCCTATGGAAGGACCGTACGATGCCCTGATGTCCACCTTCGATCGAATTATG
GCAGCTCTGGAGCTCTGCGTCAATCATGGTGGTTGGGACTACTAGCCGTAACGTCAGATCATCCCCATCTGACTCAGCTCgacttcgtcgctgtccaaAA
TAGTACAGGAGTCCGTCCTCGCTGAGTACAAAGTTATCGGCAATTTCGCTGGCATTCTGAGTCCGTCGGTGTGTGAGACCGTCGAGTTCGCCTTCACGTA
CTGCCTTCACATCTGCCCACTT