Description :
From Genome Similarity Track
Location :
contig_29:212092- 213673
Transcript NameFunction/comments
g5755.t1heat shock 70 kDa protein

Sequence
1581 bases(100 bases per row)
CTCGATGCGCACCTTGTTGGCCTCGTCCTCCGACTTGTACTTCTCGGCCTCCGCCACCATGCGGTCGATATCGGACTGCGACAGTCGGCCCTTGTCGTTC
GTGATGGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGCCGACACGTTCAGGATCCCGTTCGCGTCGATGTCGAACGTCACATCAATCTGGGGAA
CACCACGAGGCATGGGCGGGATGGCGTCCAGGTTGAACTTGCCCAGAAGATGATTGTCACGGGTCATCGAGCGCTCGCCCTCGAACACCTGGATGAGCAC
ACCAGGTGGTTGTCCGCGTACGTCGAGAACGTCTGCGCCTTCTTGGTAGGCACCGTCGTGTTACGCGCGATCAGCGTCGTCATGACACCGCCTGCCGTCT
CCAGGCCCAGAGACAGCGGCGTCACGTCCAACAGAACAGGTCGCAGCTTGTCCGACGAGTCGTTGCCGCCCAGGATGGCCGCCTGTACCGTGCGCCGTAC
GCTACGGCCTCGTCCGGGTTGATGGACTTGTTGGGCTCCTTGCCGTTGAAGACTCAGACAGCAGTTGCTGCACCTTCGGGATACGCGTCGAGCCGCCCAC
TAGCACCACCTCGTTCACCTGGCTCTTGGACAGCTTGCGTCGCGCACACCTTCTCCACGGCTCCATGGTCTTTCGGATAGTCGCCGCACAGGTCCTCGAA
ACGGGCGCGCGTGATGGTCGAGTTGAAGTCCACGCCGTCACAGCGAGTCGATTTCAATGTAGGCCTGGGCGACGACGACAGCGTCCGCTTGGCGCGCTCG
CACGCCGTACGCAGACGCCGCAGCGCGCGTTGGTTCTGTGCCATGTCCTTGCGGTGTTTGCGCTTGAACTCCTGCACGAAGAACTCGACGAGGCGGTTGT
CGAAGTCCTCGCCGCCCAGGTGCGTGTCGCCAGCGGTGGCCTTCACCTCGAAGATGCCCTCCTCAATGGACAGCAGCGACACATCGAAGGTGCCGCCGCC
CAGGTCGAAGATCAGCACGTTGCGCTCGCCGCCCTTCTTGTCCAGGCCGTACGCAATAGCGGCGGCCGTGGGCTCGTTGATGATACGCAGCACGTTCAGC
CCGGCGATGGCACCGGCGTCCTTGGTGGCCTGGCGCTGCGAGTCGTTGAAGTAGGCCGGTACCGTGATGACGGCGTTCTTGACCTCCTTGCCGATGAAGG
CCTCGGCCACCTCGCGCATCTTGATAAGCACCATGGACGAGATCTCCTCGGGTTGGAACGTCTTGGACTCGCCCTTGAACTGCACCGTGATCTGCGGCTT
GTCGCCGGCGCCCGACGTCAGCTTGAACGGCCAGTGCTTGATGTCGGCCTGCACGATCGGGTCCGAGAACTTGCGGCCGATAAGGCGCTTGGCGTCGAAC
ACCGTGTTGTGCGCGTTCATGGCCACCGGTTCTTGGCGGCATCACCGATCAGGCGCTCCGTGTCCGTGAAGGCCACGTAGGACGGCGTGGTGCGGTTGCC
CTGGTCGTTGGCGATGATCTCCACGCGGTCGTTCTGCACACGCCCACGCACGAGTAGGTCGTGCCGAGGTCGATGCCGACC