Description :
From Genome Similarity Track
Location :
Scaffold_33:212012- 215000
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010946Similar to cdc7: Cell division control protein 7 (Schizosaccharomyces pombe)

Sequence
2988 bases(100 bases per row)
ATTCGGCAGAGGTAAAACATCGATTGGAGCACGATATTTTCAACCTCCTTTCGCTTGGACCCGTGGGACGTCTTGGTTGAAATCTCTGCTTCCTGCTCGT
TCAAAAGATGAACCAGCGTAGGAATCGTGCCTGCACGATCTAACTTTTCCAGAGTGATTGGCTCCATGCTCAGGTTTCGAATGCACTTAAGGACTTTCAC
CATCGCAGAGACAAACTCGTCTGACTGACGCACTTTTTGAATCGATGCTTGGTGCGCTGGACTCTCTTTTGCACTCGGCAATACTCGTCGGTGCAGTGCC
TGCAGCAGCCCTTCGAGCACTAATCCGTCACAAACATGCTCCTTCACAACCGCATCACCCTGCGAGAACAGCATGAAGATGTCACACGTTTTGTGCAACT
CGTCCATCGTCCACTTTTTTGGTCTTCTCTGGATCGATCGGCTGCGATCTGCTGTTATGTCTATGTTCCTGCCGGCAAAGTCGTTACCCACTTCTTCAAT
GGCATCAGGAGCGCAAACCGACTTCACAATCTCGTTGAACACCACGATGAACTTTTTCAGCAGTCCGGCCTTCACAAACAGCCGACAAATGTCGTTCTTC
GGGATCGTCTGAAGGTTAAACACACTGAAAATCCCCTCGAGCGCGATTCTCAGCAAATCGATTTCGCTGTTTGTTGTCGGAATATCATTATCGAGCGTCA
AGAAATCCACGAGCACTGGCAGTCCGCCGCAGGCAATAAACATTTGCAGCGTCAATGAGCTTGTTTTGCAGCTTTGACGGACAAATTTGGCTGCTTCCAA
GCGCACAAACGCCGCGAAATTCTGTGCGCTCGTCGAATCCATGGACAGATGTTCTTCCGAGAAAAGGGCAGAGGAATAATCCTGCTTTGTGAGTTTGATA
ATCACTGGAACGAGCCCGACGAGCGCCAGGTTTTCCTGGAACTTTTGATTATCTTCCACAATCTACGTCAGAAAACAAGAAGCACAAGGTTAGCAATCGC
CCGACCAACTTCTGTTTCTAGCCTCTCCTACGTACCATGTTAATAACCTTGAGTACAGCATAGAGGACATCCATTTTCTTCATCTCGAGTGCTTCCATTA
TATTGGGCACCACGCCAGGCTGCGACATGAGATCCCTGCGAAGTGCTTGGTTGGACTCGAAAATCTCTTGCTGCACAGACATATCGACAGATTCATTGAG
ACAAGTAAAACGATACTCGAGAAAAGAGAGCCAAGGAAGACTATAACGGGACTCACCAAACTCGTGCACGCATCTAAGATCACTTGGTCGTCCATGCTTG
GATCCAAAAGTGCCAACAGCTCAACGACGCGCGACGTCGCTTTCTGGTTGTTGTCTCGAATGGAAGAGTACTCGAAGTCCATTTCGTCGTCAAATAGATA
ATCTGGCAGACTCTCGGATGCGTCTCTGGCGCTGAGCATATCTCGCTTCGACAATCGATGCGGGAAATCTTGAGGAAAAGTCGAGTCAACCATGTCATCA
AAGCCCGAATCGTCGTCGTCGTCATCGTTGAATCTATTGAAATTGACTGAGGTCGTTTTCCCTTCGACGGATTTGTCAGCGATTGACATGGTCTTCTTTC
GAGCCACCGCTTGAATCAGTTGCTCTTCATCAAAATCCTCAAAACCGAGATCGCCTTCCTCGGTCTTTTCTGAAAAACTCTGCAACTTGGTCAAGCGTTT
TTCCTTCGGCACAAGTGACGAGCGGTCCCATGATGTTGTTGAACCAGGGATGTCTGCATCTGGTACTATCTCGCTCTTAATTGGATTCGCTTTCTGGATA
GTACTGCCTGACCGCGGCGGTTTCAATGTATTCTGTGCGCGCAATTTCTCGTCCTCTGCGGTGTTGCCGTCGTCATCTTCCCACAGTTCGTCGTCAAACA
ACGCGTTTTCATCTTCTTTGCTAAGCTGGAACACTTTTTTCAGCGCCGACACAGGCTCATCCATTTTATTTTTCGGTCGCTCCTGGCTTCCTACAGGGAC
CAACGACATGGGCTTTGGAGTCGACTCGACGCCAAATTCATCGTCCCAGTTCTCAGCATCGTCGTCTTCTTCTTTAACCAATTCATTCTGGTCCCCAGGA
CTTGCTTCGACAAAGGATGACGACGTGTGCTTTTCCTTTTCGTACTTCTTGATCGTGTTGAGTACTGCGTCGCGATCGTTCAGCGAGGATACGTGTTCGG
ACACCATCTGCGAGCTTTGCTCCACCTTGTTCTTCGGGATCTGCGCGATCCATGGATGCGTCAGCAGCTCTTCCGCCGACCCACGCAGACGTGGCTCCTT
CATAAAACATTTCATGATAAAATCGTGCAATGCCTACACACGCATACCACCACGACAGCGTCAACTAAACTCCAGAGTACGTCAACACGTAAGAGAACCA
CTACACTAGGCAATTTACCGGCGAGATCCGCTCGGGGAGCGGTGGGTGGTCATCCTGCACGATCCGGAAGAGCGCTGCCATTGGCGCGAGGTCGAAGTAC
GGCGGTTTGGTCGACAAGAGTTCAATGATCGTGCACCCGACGCTCCAGATGTCCGACGCAAAGGACCAGCCCGCCATCTCAATCACTTCTGGCGCCACTG
TCAATAACCAAAACATGGGCACACATGAGTCCGTTGTTGCGTCTGCTACTGGCAAAGTATATAATCAACACTCACTCCAGTAGGGTGAGCCGACAACGGA
GTTGGACTTTTGGGTCTCGCTGAGTTTGATCGCGACGCCGAAGTCCGCGAGTTTCACGAGTCCGTCCTTCGTCGTCAGGATGTTGGCGCCCTTGACGTCG
CGATGCAACACGCCCTGTTCGTGGAGGTACGCGAGTCCGCGCAGCACCTGCGTGATGTACATCGCGACGAGCGTCTCGGAAAATGATCCAAACTTTTTCA
TAAACTGCGCGAGCGAGCCGTTCTCCATGTACTCGAGCACGATGTACAAGTACGTCTGCGTGCGGATCGTGTCGTGGTACTTGACGAT