Description :
From Genome Similarity Track
Location :
Scaffold_95:21201- 50263
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_95-fgenesh-gene-0.10Cathepsin B, cysteine protease family C01A
Pytap_DAOMBR444maker-pag1_scaffold_95-snap-gene-0.15Autophagy protein
Pytap_DAOMBR444maker-pag1_scaffold_95-snap-gene-0.16Transmembrane protein
Pytap_DAOMBR444maker-pag1_scaffold_95-snap-gene-0.17Transmembrane protein
Pytap_DAOMBR444maker-pag1_scaffold_95-snap-gene-0.18Sulfotransferase
Pytap_DAOMBR444maker-pag1_scaffold_95-snap-gene-0.19High mobility group protein B1
Pytap_DAOMBR444snap_masked-pag1_scaffold_95-abinit-gene-0.31DEAD/DEAH box RNA helicase

Sequence
29062 bases(100 bases per row)
GATTCCGTGCCTGGGAGGGTAATGCAGCTACAAAACAGAGACCATTAGCGTGCGCTCAACTGAGAGCCAaTcATGGGTACTTACTTCATGCAGTAACCCT
CCGGTGGGCAAGTGCCGTTGGTGCTCGTGAACTTGGTGTGGTCCGTGGCGTTGTACGGGAGGCACGACTCGTCTGGAAGACCGTAGTGGTGCATGAACTC
GAACACATCCGATGGTTCACCGCCACCACAGCCGTCCGAAAGGCCGTGGGCTGGACCACAGTTGAGGAAGGTCTGGCGACCAAGGATGACATCGGGGCCC
TTGTATCCCTGCTTATTGTGCTGGATCTTGATACGATCCTGCGCGGCCGAGAGCGCACCGTGCGCGAAGCACGAACCACAGTACTGTGGAATGTGCTGGT
TCCACGACGGtGTGCAGTAGCCCTGCTCACACCAGTCAAACTTCTTGGGGAATGACGAGAGTTCGAGCGTCTGTGCGTCcGTGAGCGGCGGCAGCGCGTG
CACCTTCGGGTGCAGGTGCTCTCGGTTCTTGAAGGTGCGCGAGCAGACCTTCTTGGCGTCGGCAGAGgCGGTCACGAGCAGCGCGGCACCCACGAGGGCG
GAGACAGCTACCATGGCGGCAGGCGGCAGGAGCGGAAGTGATGCATGAGGTCCCcAACGGATCCACATCCGCACACACAACCGTTGATGGGAGTTACGCG
GGCCAATCAGAGCGCAGCGAACCTGACGAGGACCAATCAGATTGGCGCACGCGAAGCCAAACCAGAACACGAATGCTTACCCACCAGCCAGCCCaGACCA
GCTGGGAAAGGAaGACCATCACTCTGCCAACACGCCTTCAAGTGGTCCCTTGTAGCGTCCCCAACTGAGTTGATTTGTCCCTCGTGGGGATATTATCGTA
TCCCGTATTGATGCATTTgcTTTCCTTTCCaTTGAAgtgAGGGGGGGAATATGGCGGCGGATATGACGCCACTGCGCTTCCAGGCGTGGCAGAGCGCGCC
CGATGTGGGCTTCTGGCAGAAGCTGGCGGCGCTCAAGCTCGACAAGTTCCAGCTCGACGACCGACCGCAGCGCATCGTTGGGTACTTTGCCCCGGGACGG
TCGCCCACAGTCCCCGCACGTTTGACAGTGGATGAGAGCGCGTTCGCGGCGCCAGGCGACGAGCCgaCGGATCGCGCTCGGTATGAGTGGAAGGCACATG
GGCTTTTGGTTAATACGAATACGTTGGAGGTGAGTAGAAGGTAGGGAGATGAATTAGAACGACGCTGACGACTAGGTGAACAGGACTTTAAGGCCCTCGA
CAAGCAGGCGCTCCTACAAAAGGCCGCTGAAGACGTAGTGGACGCCGTCACGAACAAAGATGGGAGCTCCGCCGAAGCGCTAAACGCGTTTGTTGTTGTA
aCTTTCGCTGACTTGAAGAAGCATTCGTTCTTGTACTGGTTCGGATTCCCCGCTCTGGCGCTACCTGATGCCGTTGTAGCGACGCCCCCGTGCAGTGTCA
GTGCTGCGTTAACCCCAGAGCTCCAAACTGAATCGCTCAAACAACTAATGAACCTCCGGAAAAAGGATACGGATGGAGCGGTCGGCGTATTTCCCGCCTT
CTTCGTAATCGAGAAATCGACCACAAGTGTCCGTGTGCACGAGTTTTCTGCGTGGCGAAATCTTGAATCGACTACAGAGGATGCGGAGATTCTCTTTGGT
TTTGTTGACCCATGTGCGCTGCCGTCAAATCCAGGCTGGCCTCTCCGCAACTACGTCGTTCTCTTGTCCGCGTTACCAGCGAGCAAGCTCCGGTGCGATG
CTCCcATTAAAGTGATATCGTTCCGAGAGCATGTTCGCCACTTGGACAGCACTCAAGTACCATCGTCcGAGGTCTTTGAGTGGAAaTCATCTCGCTTGCT
GGAAaTTGCATtAaGCTCGACATCGAAGATAGAGGATGTCCGCTCACtCAAGGTTgTGGGgTGGgAGGCCAaCGTGCgAGGgAAGATGGGACCACGTTTG
ATGGAACTTGGAAGCATGCTGGACCCTGTTCGACTGGCCGAACAAAGTGTTGATCTAAATCTGAAGTTGATGCTGTGGCGACAACTTCCATCTTTGAAAC
TGGATGTTTTGTCCACAACGAAGTGCCTTGTTCTTGGTGCTGGTACCCTTGGGTGCTACACAGCACGAAATTTGTTGGCATGGGGCTTCCGCAACATTAC
ACTCGTCGACAACTCCGTCGTCAGCCACTCAAATCCTGTCCGGCAGCCGTTGTTTGAGTTCAAGGACGTTGGTAAGTCAAAAGCTGAAGCCGCTGCGGAA
TCTATGAAGCGTATCTTCCCACTCGTTAATGCGACTTCATGTCAACTATCCATACCGATGGCCGGCCACGCTCTCAGCAATGACCACCTTGTAGTtGAAG
CCAAGTCAGCGCTATTGAAGCTGGACGAGTTGATTGAGACCCATGATATTGTTATCCTTGGTACGGACTCGCGCGAAAGTCGCTGGCTACCGACAGTCAT
GTGTGCTGCCAAGCAAAAaGTATTACTGAACGCAGCCCTCGGATTCGATAGCTACCTCGTCATGCGTCACGGAgTTGGGGCCTCCTCCACTTCGTCGCTT
GGCTGCTACTTTTGTAATGACGTTGTAAGCCCGCGCGACTCcCTTAAGGATCGCACGCTTGATCAAATGTGCACTGTTACTAGACCCGGGCTTGCACCCA
TTGCGGCAGCCACGGCAGTCGAGCTCCTGGTGGCTTTACTACACTCTCCGGATGGCGTCCACACCGGAGCTGACAAGCCACATGACGCATCTGTCCCGCT
TGGCTACgTGCCTCACCAGATCCGAGGCTTTATGAACTCGTTTGGGTCGATGGTTGTTACAGGCGAAGCCTTTGACCGCTGCATTGCATGTAGCAGAGCT
GTGCTAGACGCCTTCCGTGATGATCCGTTCTCACTTCTGCAGAACGCATGTAATTCCACAACATTCCTTGAAGAACTCACAGGACTtAACAAGCTGACTG
AAGCGGCGGATGCATTTCTCGATGAGCTCGATATCCAAGACAGCGATTTCGACGAGGAAGAGGACAActCGCTGCTTTGAGAAggagAGAAGAGTAGtGA
ACATGGCTTCATTTATGTATTATCAAGGGCTCCCTCTGTTATTGGATGAGATCTGGTGACCTTTGGCGGCCCGTCGCATTGGTAGGAACAGCTCTCGAGT
GCATGCCATGACGcTCCCCTCGACAAGAGCGACTACGAAACAGCGATGGATCTTACTCCTCACGTTGTTGTGTTTGCTGACGttGTATATCTCCACCAGT
GATGGAGCCCTCACACCCGACGAAGCTCAGCAGTGGAGAAGAGATAATGCCAATTTCGATTGGCAGCAACAAGACGGGAGTAAaGTACAGATCGTGGGtc
GTGGGGCTGAAGATACGGCAGGAAATCTCTACTTTGTCGGCACGAAGACATACCCTGACAGCGATGGGCAGTTCGTGGACGATCAGAACATGTTTGTAGC
CCGGATAAATGCTGATGACACCATCGGCTGGACACGTGAGTTCGGCACAAACGAGACCGACGGGGCAAACTTCGTGACGATTCTAAGTCAAGCCAaGGgA
GGCTCGTTTGTTCCATATCTCTACGTAGTGGGGTGGACGTGGGGATACATGGATGACGGTGCACACGCGCTTAATGGATTCGGgCATTTTGGTGGGCGCG
ACGTTGTTCTGCTCAAGCTTGCACTGGACACAGGCCGCAAGATCTGGGCACGTCAGTTCGGCTCAACGATTGATGACATGGGCTACGGCGTACAGCGTGA
TGGTGGCTTCGATTCACTCTTGTTGACAGGTGTAAGCTCTTCAGACCAAGTGGATGGAGTCATCGAAGTCAATGTAGAAGTTGAGACCGAGCCACGGCAG
AAGCCGTTTTCCTTGCATGAGACTCaGCTCATGGATGCCCGTGCCAGAAGTGGTGTCAGTCAAATGAGCCAGTATCAGTTTGCTGCTAGCATCAGTCCAC
AAGGAGATATTCTCGATTTCACAATGGATGGAGGAGTGACGCTTGCACGGCGAAGGCAGCGAATCGCGGAGAACAGTAGCCTTGTGGGAGAATACGCGGT
AACTCTCAACCGCCGTCCACTTGAAGCTGTGACTATCACAGCCACAATTGTGTGTCTTCCTCATCCTGCCAATGTGTCGACAATGGTTCAGCAACTCGTA
TTTTTGAAAACAAACACCACACAGCGAATACTTCACTTCACCCCAGACAAGTGGAACCGAGAACAACTGGTTCATGTGGCTCCAGTAGACGATTCCACGG
CTGAGGGTGTTCATTATGCTGTAATAACTCATTCCGTTTCAAGTCGGGATCCGAATTTCAATGGAAAGAGCGCGCCATTCATTTATGGGAATAATGTCAC
CATGCAGATCGATGACAATGACGTGCCTGGCGTTCAGCTATCGAGACGCCACATGTTTGTCGGTGAAGGCGGGCTTCGTGACACCTATCAAGTCGTCTTG
CGTTCACAGCCATGGCATCCTGTAACAGTCAAGATAACCTCTCTTCACTCAGCTCAAGTTATTGCGACGCCCGATGTGCTGACATTCACGCAAGCCACAT
GGAATATTCCTCAGGTTGTCACAGCGGTTGCTGTTGACGACAACGTGTCGGAGAGTGAGTTTAGGGGTCTCTATTTTGGCGGCCGCTTGATGCATTCGAG
TGAGAGCAAGGATCGAAGATATCACACACGCCGCCCCGTGTGCTTCGATGTCGCCAGATGTGATCCAGAGGACCCtaCTgTCTGCCTTAGTGAAGATAGT
TCTGCTGCAACCGTTCGTGTGTGCGACTTGCTCACACCTCAGTGTTATGGTCGTCTGGGTAACGGAGCGTGTATCGCTGATGTCGGTCCTATTGATGGCC
TCCCTCAGCCTCGCTTTGGGGCTCCTCCACTGCTCGATTTTGATCAAGACGAAACTGAAACTGAATCGCTTTCATACAATGAACTGAAGCTcATCTTAGA
CGATCAAGGAGGAGATATAGCGCGTgTTATGGCGAGTGGAATAGCCAGTGAAACAGGGAACTCGACGATTCCGATGATGTACCCTTTCACTAAACCTCCG
GCGCGGCTTCGTGGATTTGTTCTTAGCTTTTTGGGGCTTCTCAACCTTGGTCAAGCTAGAGAAGTGCATCGAAGTTTTTtCCTGTCGCTTCAGTCGGTTT
GCAATGGACTTGATCGGATTGAAACTCATCAaTGGGCATATAGCGTATGGCCCGAGGGTATGCTTCCTCAAGTATTGAATGCGACTTTGAACATGTTTGG
TGGAAGTGTAcAGGCACGCCACCTATGGCGTTGTGGGATGGCGTCGTTTCGACCTGGGAGCAGCAGCATCAATGTCAGTATATGGGACAACGACGCTGGA
GTCACCATATCGACAAGATCACTCACTGTCTCCGAAAaCGGCCTCGCAGCTACCGGATATTCGATTGTTCTTAACTCACCACCAATTGAAAGTGGACTCA
GCAAACTGAAGCGAtCGTTTTGCGCTGTGGCAAATTCCGACGATTGCGGACTGTGGAGTAACTATTCCTTACTAGCTGCGTCAATTTACGATATCCCACA
GGTGACTGAAAATGTGAGCATTGCGATCATCGGTAgCGCTCATGTTGCAGTATCACCGTCTGTGGTGACGTTCACGACAGCGAATTGGTTCCTTCCACAA
TGGGTTACAGTTCGAGCAGTTGACAATAGTGTTGCCCAAGGTGGCGAGACCTTCAATACGACCATTACGCACCGGGTGCAGAGTTCACAACTCGGATACA
GCGACGAGTTCACTGCGTTTTGGTTCAGCGACAGTTCTCCACAAaTGAATGCTTTGTTtCCTCGCTGGCAGAACAAATCGGAGGCCAAAGCCTTGCCATA
TAACTTTATGCCGACcGTCATCCATTCGCCACAACACAAACAAaTTAATGTTCGTGTTGTTGATGACGACGTCGCTGGTGTCATTGTGTCGGCGCCTCAG
CCGCAGGGTCGCATCAAAACGCGCGAATCCGACGACACTGAAGACAACTGGGTCGGCGACTCGGTCAAGTCCATGGCATTtGGAGACATCTCGCTCACTG
GATCCGAATCATCGACATCGCTCGGCAGCGGTGCAGCTCTCGAAAGCGTTCTAGTATTTGAGACACACGCCACGACTTATATAAAGTTCCATCTGCCGGA
GCGACACTCGGGCGATACTGATGTCTCATTCGCGTTTGCAAGACTGCGAGTGTATGAGACCCCATTCAAAGTCATCAACGCGTCAGCAGACGGAGCaGAC
TTGTCCGAGTCTGCGTCTTCGTCTGCgTTTGAGACGTCTTACCAATTaCGAATCACTGTCGTTGATAACGCTTGGACACGCACTCAGGTGAGTAATGGAA
TCGTCACTCCATCTCCCGTGACGTTCATGGGAGATGATCATTCGATTGAGGTGACGGCGCTTATGACGAAGCAGCGCTTCGCAGCCATCGATGTGACACC
ACTCATCAAGCGTGTTCTGCCAACGCGACTGCCTGTTATATCTCTAAAAATTCAAGTGCTCAGCTCAATCAGTCCCGGCGAAGGCGGCGGTTCGGCTACT
GATATCACAACTCACTTGTGCTCTTCGCTGTTTGAAAGGGCACTGCGCCCATCGCTGGTCTTCGGGTATATGTTTCCGAATCGTCTCCTCGGTGGAATAA
CACGGCAGAGCTCTtCGGTTACACCCTCGTCGACAGCTGTGGACGGTCTTCGAGCAGCAGACTCTGCGTCAGAGACCgAaGTAGAGACGAATCCGTGGTG
GgAGGTTTCCCTCGCACGCCTCGTGCGTCTTGGTTCTCTTGcGATCTTCCTGCCTCCGACCCATGACGATGCTGCGAAACACTCAGCATCCGTGACGATC
ATCGCATCGTCGATTTCAATGGATGACTCACCTtcAACTCTGGAAGAAGCCaCGAAACACGGATGCCCAGATGCGTGTCCCAAGATTGTGAGGCagCAGC
TGaGAAAAGCTCTAAtAATTACGAGGATCGATGCAGGAGTGCGGACGCTACGGATCTACCTCCAAGGCGTTGGGTCCCTCCGGCTTCGTCAAGTTGAAGC
ATATGATCCTCATGTGGTGTTGACACCAACAGCAAACGGACAAGGTTTACGATCGAGACTCAAAATGGATTGGAACGGTGCTCTCCGCAGCGACTCGTGG
CGTTTGCTGCAGACTATCCGCCAGTCAGACGAaGAAAACTTGGCGTTGGGAATGCCGACTAGaCAAAGTTCGACTGATCCGGTACAGGCGATGAGCTCGC
TCGCGGTTGACGGAGAAAAACGGCGAAACTGGGACTCGCTCGTGTGgATAAaCGTTGGTtCcGATAaCAAAGCTGATACTATCGCGGgTAGCACACGTAC
GAAAGAGgAGAAaGATCCcTGGTGGGAAGTGGATCTCGGCGAAGCAGCTCCAATCAGCCAAaTCGAAGTATTtCCTTATATCGGCGATCGCGAGCGGGGT
TTTTGCAAACCAGCATCAGTAACCTCAACAATACCGCAATGGGCAGGAGACTTGTATGTCTACAGCAAAACTGATGAGCGgTTGCAGCTGCAGGATCCAT
TCGTGCAGACATTTGAAATCGTCCTGTCGAAcGCCCCATTGTCAACGAGtGAGGTCTCAGTGGTTGCAACCAAGACAGTCACCTTCTCGTGTGCAGGAGG
AATAGTTTCGACTGTGTGGTCTtCCGTTTTTGCGAAGGCTCGCTTCGTCACCGTTCGGCGACCAGGAGCGAATGCCACTCTGATGCTGAACGAAGTCGTG
GTCACGCGTTGGAACCCTGCGACAacACCCcAGTACGTGCTTGTCAGTCTGCGTGGCAACGGCGAGACACCACTGGCGCTCTCTAGCATTCAGCTcTTCC
CCCcAAGTGATCAgAaCAACACGTACCCTGTACCGCTAGTGTATTCAATTCATAGTGTGAGCTCTCAGCGTGCCAGTTCGGGTATGGGCTCTGCCTCAGC
GTTGCTAAGCGCATCGACGGCAGACTGCTACATCGCCGAGTCGCCTGCGTATCGCGAATGGGTGGTCTTAAAGCTCGAGACGCAaTCGCAAGTtGGGCTC
ATTGACGTGCAGACGTCTGTCGACAAGTGCGGACCTGGTGTCTCTCCTATTTCTGCGATTTCCATATCCGTTCGTGGAGCTTCACTTGACGGTATTCGTT
CGGTCGAAGCTgAGGCTCGCCTCACAGCATCAGCACCTCCAGATGCATGCATTTtGGGTGCCTCAGCTCGGCTTGTAAACCCTTCGGCGTTATCATCTGC
ATGTGCGTCGTATATGTGTGAcGACCCATCATGCCGAGCCATCAGAACCACAACTGATGGTATtGTTTTtGGTGACTTCAACGATATTGTTCTGCTTGGA
GTTCCGTCACTTGCCCCATCATCTCGCCTCCCTACAAttcAGCACGACGCTCGAGCTATGCTGCTTCGAGATAATCCTGTGCAGTTGTGGTTCTTCGAGT
CAGAGCTCACGACTCAAGTTTCCCGCACCCGAGTAGCGACAGCGTTTCTGATCGCGAGCACATCAGCGTACAAGTCACTGGACATTGACGATTCGGTTGA
GCAATCGTTTTtCTCGAACGCTGTCGCCGTGCAACCGGCAATGAGCGCTTTTAGTATtGAGTTTTGGCTGTCGCTGAGTTCATTGTCCACCAACGCCGTT
CTCGTGGATGTCATCACACCGTCGAAGGCTGTAATTGCTGATCTCAGCATTACTGGACAAGCTCCTCGTGGTATCTTCACCGTGcGAGATCCTGGTAGTG
GCGGTTCCTGTGCTACCAAGcTtCCGTCTTCCTCTACGGTGTTTGATACCATCGGCCGCTGGTACCACATTGTCACCTCTTACGACCCGAAGAACGCgCG
TATTCTGTTATCAGTGCGCTCTATGGCCGATGATGGCACTGTACTGGGTTATAACAGCAACGTCACGTGCAATTTGCCGCTGTTGAGCTCGGCTGACAAG
ACACTCCGATTTGGTGCCACTGAAGCGCCGTCGAAGCCTGGTTTTGTCGGACGCATCGCTAATGTCGCGTGGTACGTCGACGTGTTGTCGTCTCGTCAGA
CGAGAGATCACTTTCATGACTTCCTGTCTGTTGGCACCTTTGGTCCCatACACAACTCGTACGGATTGCGCCTTGCATCCAAGCCAGAAACCCCTGTGAG
GATCGACGTCAATGCTGAGAGCGCATGCTACTATTTCTCACTATGCAATATCTCGGCACTACCGAGTACCATCGTGTTTCTCCCAGAAGAATGGAATGTG
ACGCAATATGTCAATGTCCTCGCAACGGATGATCAGTTGTACGAATCTCTACATCAAACAACAATCTTGCACGAAGCGTCTAGCCAGCCGACTTATACTC
AACAGACCCAGACCGTAACTGAGGACCTGACTGGCGTCGACGCTCAGAAGTGGATCGAGTACAAAACTGCAGTTGCGCGGTATGACCGAGCAGCGGTATA
TAATCGCAACACCTCGGATTTTATCGACGAGCTTGACGCTCAGCTGCAGGGCATTCATCTGAACTGGTCGACTCAACTACTCTTATCGTCGTTTTCTGAG
AGCCACGCCTACACAATGTCCCTTCCTATCGGCAACACTACAATTGATATTGAAGATATGACGATTCCTGGTATCCAGTTTTCCACAAGCTCTCTCATTG
TGACTGAGAGCGGCAAGGGAAaCGACTATCAAATTCTCCTGCTCTCAAAGCCCACAAGTGATGTCTTGGTTGTGCTGGACGCTCAGAGCGACTGCTACCG
TGATTGTTTTACTCAACCTCAGTGTCCGACTCAGGCAGCTACCGACGACCTGTCGTGCGGTGGTGGTTCGTCTGGTGCCAAGTTGTGCAACATCACTGTC
TGGCCCAATGAGCTTGTCTTCACACCGACGAACTGGAGCTATCCTCAGACTGTGCGGGTTGTCGCAGTCGATGATTTCTTGGACGAAGCGGACGTACACC
TGACGACCATTAAGGCGGCGTCATATTCGGCTGACCCTGTGTACGACGCATTATTTCTACCCGATaTTGTCGTCGCAGTCGAAGATAATGATGATACCGG
GATCAAATACTCGACATTGACTGTCTCATTAAaCGAGAcGGATTCCAGCGGCAGTCGATACGACCTGACACTGAAGACAGAGCCGTGGGCAAATGTCACC
ATTGCTATGAGCAATGAGGCCGATGGTCTCTGCTATCGATCGTGCGGATACCCTTTCGACGAGCCCGATTGTGGACTGCCTCGTCAACaGAGCGTGTCCA
CaGTCTTACTTGCAACTGATTCTCCTCgTGAGATCCAAGAGATCAGCCTTCGACTGCCTCGACCTCGCGTCATGGAAGTGCAGCGAATCGTGACGTACTC
AGACCACACCGACCAAGTATACAGCGTACAAGTTACTGGCGGTTTTGCCCCGGATGTGCAAGTCATCGAGTTCGCTTTCAACAGTGCTTTCAAAGCTCGT
TTcAAGACAGCGGAAGCCAtcACGTCACCCAATGCGGTATATATTAGGAGCTTCAAGAtcAGTGTGTCGGGCAGGGCAGCGCAAGGGTACTCGATCGATG
GGTTCTCAAGCGCAGACAAAGTTGCCACAGCGATCAATGCTGCGCTGTTCGGGCGAAACACCAAAGAaaaCGTTGTGCGTGTGAGgCGCCAGCTCCAGTA
CGAGGAGTCTGTGTTGCGTTGGCAAGTGACGTTTCTGCGCTTCCTCTCTGACGATCTGAGCCTTCCACTGTTagCGGCTACACCGGACTCACCATTTGAA
GGCACACTCgAATGTAAAGCGAGTGTCGAGTGTGGTGTCGCCCTCCGGATCGCTGCTAaTAAAGTACGGAGTCGGTGACACgAaCCTCGCCAGATtCCCT
TTATCAAGCAGctCATCTGACGTCGAAGCAGCcaTGAGGGATCTCGACACAGTGTACAAcGTTATTGTGTCACGCCGTGCTcTCAGCAGCTCACACGATT
ACGGATTGaTTTTTGGAGTCACGTTTGTTGGTGTGGAGatCTACGAAGAGCTTGTGGTATCAaCAGAAGAGCTGCTGCCAGCAAAAGACgCACTAAGCAG
CAGTATCAGAGCACAAGTGTCGGAGCAGCAATCACCTGTGCgCaTTGGGGGCACGTTCGTGGTTCGgTACAACaGCCCATACGTGAATGTCTCTGCGGAT
GAGAACGCAACCGAGCCTGTGAAAGAAACCACAGCGAtcTCGTGGAACGCAAGTGCAGAAGAAGTGGCATTGACGCTAGGGACTTTGTATGGTATTGGGC
CTGTCAGCGTTGCACGCAGACAACTCACACCAGAAGGGGCGATGGACTGGACAATTGCTTTCACTGCAAACAACGGGAACATCTCTCTCTTGGAAGTCCA
ATCGGTCAATCTGACAGGTAAAGGCGTCACTGTaCAGGCCATGACAGaCGTCGACGGGGTCTCTCTCGGAGGGgTGTTCACGATCCAAATGGGTGGACTA
TACATCAAGACGCATCCTGTAACAAaGCGGGTGtACACCAAAGAAGTCGACAAACAGAAGACgCcGGgACTCGCGTTCAATATCAGTGCAACGGATCTCG
AGACTGCCCTAGAGACGCTAGGCATCACGGAGCGtaCAAAGGTGACTCGAGAAGGTATCGATTGTGATGCATTCAGCGTGTGCGAAGGTTTTGTGTGGAC
CATTAGCTACGTATTTAGCGCTGGTAACGTGCCACCGATTCGTGTGTACGGATCCAATGAGACTATCACCGGTGCTGGTGCgACCCTCGAGTCTAGGACC
ATCGCCAAcGGCACgTATCTAAGCGGCTATTTCTCACTCGAGCTTGAACTGAATGATCCCGAAACCAACACTATCCATCGAGCACGCACGTGGAaCCTAC
CCGTCAATGTtaGCAGCGCAGGGCTGGACGAAGCACTCGAAGCCATTCGATGGGTTCGCTCGAACAGAGAAGCTGAGTTCAATCCCGAGACAGGGCTCAG
TCGTGGTGTtCTCTTTGATAAAGGCGTGCGCGTGGAGCGTGATGGTCCGTTTCTTGACGGCGGCCACTTTTGGCGTCTCGCgTGGgCAATCGAAGATTAT
GTGCGGTTTCAGGACTTGAAAATCACCATCAATACGTCTCTGGTAACGCAGCTCATTGAACCGCTTCGAGTGCCTTCAGAATTCGACCTCACTGGGAAGC
CGCGCTGTAGTGCTATCCCTCACGCACGCTTCCGGGCAGATGAGACTGACGCTTTTGGCTTACGAGGCTTTTGTGTGTACGACATCGTCAACGTCACGAG
ACAAGAGCGGtttctGTGCAACTAtACGGTCGAGAACCCGTGGGTGGTATTCACACCCGAGAACTGGTGCGCTCCTCAGAACGTGACGCTGACGCCTGTG
AATGACTTTATCGATGAGGCGACAGTGCAGAACGGAAACGTGACCTTTTCGAACGTCACTCACACGGTTTTTAGCGACGACGTGATCTACAGTGAGCTAc
AaCTCAAGCAGATTGTGGTTGCTGTAGACAGTGACGACGTGGCTCGGGTGCTCGTGTCGGAATCGCATCTTGACGTGAGCGAAGACGGATCGgTTGTGGC
GTTTTACAACcTCCAGCTGACCACCGAGCCGCTCTATGATGTCAAGATCATTGTTCTCCCGTGGCTGGATGGAGCGGACACCAAGTGCTACCGCTTCGGT
CTGTGTAACCTTACGTTCCCCGTGGACACGTATGTCTTCACACCACGCGATTGGAATGTGCCCCAACAaGTCGAAGTGCGAGCAACGGACGATGATTtGG
ATGAATACGACACCCACGACACCGGCATaTCTCACGTGGCGTACAGTGACGACTTGAAATATCATCTCATCCCGAACATCCCACAGATCCAAGTGACAGT
AGTTGACAACGACGACTCGGGCTTCTTCGTGAACCGAGCGTTTgTAAACGTGACCGAAGGCTCGACGGTGGATTCGTATgaaGTCGTTCTCagCTCCGAG
CCATTTGCCAAGGTGATTGTCATGGTCGAGAATGTAGGAGAAAAGGGAAGTTTGGCCTCACCAACGCCTaGGCGATTGGAGTTTACGTGGCGAGATTGGA
ATGTCCCACAAACCGTGGAGGTAGCAGCAGTGGATGACGATACTCAAGATCCGGTGGGCTCTTCGAGTGTGCTTGTGCATTCGATTCAAACCAACGATGC
CATCTACGCGGCGCTCCGAAACCTCGCAAGGGTCGTGGTTTGGATCGATGACAACGACGTTTCTGGGTTGGAGCTGTCACTGACTTCCATGAACGTCATT
GAGCGTGCtCTGCCCTACCAATACAGTGTCCGCCTGACTTCtGAGCCTTGGGCACCAGTTGTGGTGACTCCGAATGGAGATCATGACTGCTACGTCCGCG
CAGCTACTCAAGAGCGTGTCTGCAATGTCAGCATTATTACGAAGGCGCTTtACTTTGGAGCTGGGAACTGGAGCCAGTGGCAGTCCGTGGCATATTTGGC
GTTCGATGATGCTCTGGAAGAATCGCCCATTCACGCCGCCTCGATCTCGCATGcgTCCTACAGCAAAGATGCGCTGTATGTtGTAGGCGAGTACACACAA
CAGCGCGTCGCGTTGCTGATTGAAGACAACGATTTCTCGTTCGTGAACATCTCACTCGCTGTGGTGTCCCACAGCAATACCACAACGGCACGATCACGGT
TACACGTAGCAGAAGGCGGCTTCAACGACTCGTACTCGATCCGACTCAACTCGGAGCCCTATGAAGATGTCATCCTCACAATCGGTCCACGTATCGAACG
GATtGTCAGTATCGATGCGGCCGTGAAACCTGTGGATGCTCCCCAAGTCGGTGCTGCCCGAAACCtcAAGTCCAGTTGGCCCTCAGGAACCTTGCAGCTT
GTGTTCTCGTCTCTCGACTGGTTTaTTCCGAAAACCGTGACTGTGTTTGGCGTCGACGACGAAATCCCAGAAGATCCGACCCAGTTTTCAGCCATCGCTC
ATAGCGTGGAGAGTGCAGATGCCAAGTACAACGTCTCGAACGCGTCGCTCGGCATTGTGGATATTCCAGTTCTCATTAGCGACCGAGAGGCTGTTCCGCC
TCCTCTTCCCGTTTCTTCATTCTTTGACGCTGCGGGcACCCGCCTGCTTATCGCTTTCGACTCGCCTGTGTATCATGCAGCGACGATGCTCATaCGCGCT
TCGTCCACTGGCTCCGcTtATGGACCGCGAAACACGAGtttttCCTGTACACTCGTCTTGGCGTCTGGCATCACGTCACtcGGGAGTGGAGCGACCTGCG
CGTGGCGACTCGATCTCAAGCGGCTACGAATCACACTTGGAGTTAACGCGACCGtGgTGCCAGGTGACGTGATTCTTCTTCACGAGTGTAAGGCGTTCgt
GAACCAGGTGTGCCAGTCGGGCAACGTCTTAAGGGCGCGTCACACAAGTCGAGCATACACGCAAGCAGTACTCACAGTTCGGATGGACCCATtGGCAACG
ATCCGACCTCAAGTCGTGCTCAGCACGCCCAACCAAGTGGGGTCATGCGGTGTCTGGCGTGTCGATGCGACTCTGACCACAGGCTCAGCAGGACGCCAGT
ATCGAGCAGCGTCATGGTTTGTGCTGCCCAAAGCCGCCATGTCGTCTGGTACTGTTGAGGCCTGGCTGTCGAAAAGCAAGACATTGTACGGTGCACTGGG
ACCTCTGTGTTTCAAGTACGAGAAGGCGACTGTGATGACCAAGACCGACTTGTCTCCTGAGCTCTCGAGCTTCATTGATACACTGGAGCAGCTCTGGACG
GTGTGTTACTTGCGGACACTGTCACTCGCAGCGTCAGTGGCGAAAACaCTTCAACTTTCCATTGACAACACGTTGGTTCAATCCGACACGACGTACGTTG
TGGGACTTGAGCTCACGAATGCGTTCGGTCAACAAGGCGCGGCTGTCCAGTCAGTGTATGTTGGTCAGCAGCCACGTCCTGAAGTGTTCGCCGTTGGACC
CACGTCGCTTGTCGTGTCGCGGGGGgAGTCATCGCTTCCTGTTGTCGTACAAGCGgACGCTACGCTTAGCTGCCCTCTGCTGTCACAGGGCGTCCAGCAG
CAGCTCGTGTTCCGTTGGTTTGCCACTGTTGCTGATACTGGAAGCGCCGTTGAAGTGGCCaTTGATCTCAATGCCACCAACACAGCCAAGGATCCACGCG
TGTTCCGCGTGCCGAGAACCCAGTTgcTCCCAGGGAAGACGTATCGGTTCcGAGTCGATGCGTGGACCCAGTCGGCTGGCTCATCGATCCCAGTCGTGGT
CAGCGCCAAAGGCAGCACGTCATTCTCTATCTCTGTCATCAGCAGTCCGCTGGTACCCGTTCTaCGTGGTGGTGATCGTGCCATTGGTGAGAAAGACACA
TTGGTGCTGAACGCGTCGTTGTCCGTCGATCCGGATCGAGACCCCAGCGCCTTTGTCTACGGGTGGCGATGCGAGGACTGGACAGCAGTAAaCGCCACAG
TCTTTGACCCCAGTCCATGTATCAATGCCTCATCACCGACACGGAGTGTCTTGACGCTGCCTGTCGCAACTCCGTCGACGCTGTTGACAGTCGATCCGTT
TACGCTACAGCCTTTGCGTGTTTTGCGCTTCCACCTAACGGTTAGTAAGCCAAACGCTGTGTCCAACACAGTGCGAAGTGCGACCACGTTTACGAGCGTG
TGGACCAAGAATGGCAGTGTCCCCGATGTCACGATCCAGGCATCCGCCACGAGATTGACCCcGTCCACCCGACTCATaTTGAATGCGGTTGTTACGTCTA
CGTATCCCTGCACAGTACGCTGGCTCGAAGACGAAGGCGATCTACACCTGCCGCCAATTGGAAGCAACCAAaCGACACACGAAGCCTTCGCCCTGCCCTT
GACGACCCCAACGAACGCGATCCTGAAGGACAAACTGACGCCTGGACAGCGCTACCTTTTGCGGCTTGTGGCGACTGATATCAACGGCAATGTCGGCTTT
GGGCTCGTTGcATTCACTGTCAACGCTCCTCCGTCGCCCGGTAGTTTCCAGATCTTTCCTCGTGAGGGCTACGCCATGAGTGACGTGTTCTCCCTACgAA
GTCTGCagTGGACTGACGACGTCGAAGACCTCCCGctgCAGTATGCGTTCGGCgTGCTACcAaCGGCTGTGTTCGATACGTTGGCTTTGAATgCCACGCG
CATCCGTCAGCAAATGCTGCCCCTCGTGGCGGGCCAGGCCGTGCCCACAGCCGCTGTGACGATGCTGCCGCcAGAAGGGCTCTCGGAGAGTGTCAGCATG
ACGGTTGTGGCGCTGATCACAGATGCCATGGGCAGCACCGCCGTTGCGCACGACCAGCTGACTGTGCGGATGCCAATAGCAGCCAaGACGGAGCCTGTGG
TGTTCGCATCGCAACTCCTCGTCGGCTCCGGAagTCCGCTTGCGAGCGCCcTTGACGCCTCGACCAAGACCAAaTATCTCCTCTCAGCGGCTCTCGTGCT
GCAGCGTGCCATGCAGAACGCTGCTTCAGCGCCCAACAAGTGTCCaGGCGATAGTGAAGCTGGCGATGTGTGCTCCGGCCGTGGATCGTGCGATCTTTCG
ACGTTctCGTGTGTCTGCAGTaCTGGATTCATGGGTCCTTCGTGTGCGCTCAAGACGGCGGATGTTCGCAGTGTTAACACTGTGATTTTGGCGTCGCTtG
GAAGTTCTGCAGTCCAAGCAGCGGAGCCTTCGCCTTCAGGCCTTGGGCAACAAGTCCGTGTCGTTGACgCTGTTGTGCAGTCCACAGGAGCAGCGTTTGA
TACTAGCGCCATAGGGAAAACGACTTCGTTGATGAGTTCGATCGCTGCCAATGCgTtAGCACTTCAGGACTCAACCGACTTCTTGGAGGCAAGCGGACAG
GCCGTTTTGGGAGCTTTGTCGACCATTCTTTCCATTCAAGCAGCCCTgaGTGATTCGACACCACCATCATCACGTCGTTtAGCGTCAGAAGATTCCGCCT
CGGCGGATgaCTCTGCTGCACTTGTACGGTGTGCCAGTGAGAGCGTCGAGACGCAGACAAGTTGGAATCAGCTTCAGCAAACCTTGCGGTCACTCGCGGC
TGTGGCGAGTCAAGACTTGCTTCCTGGGgAGGCCCCAGCACTGCTTTCATCTGGACAAGTCACCGTAGCCGCTGGAGCGGgTCGTTTCCTCGCGTCAGGA
GCCATGAAAGTCAATCTGACGCGCACCGCAGTGTCTTGCCTGTCGTCTGCAGATGGCTTGGACTTGTACATGAGTGTGTTCGAGATGGCGGCcACGACGC
ATTCGACATGCTCACTCcATGGAGCTTCTcACTCTCTAGCTCGACTATTGTCAGTATTCATGATCGCACGTCGTTGTCCGTcGCTCTCTCGGGTCAGCGA
AATCTTCAGCCTTTGAGCCTCAACAGTGAGAACTCATGTGTCAGGCGAGCAGCGACAAGCAATGAAAACACTGTCTCAAATGCCCGGCGCCTGGCGGTCG
CCTCGTCAACGActGCGTCGTCGTGGCAGCCACTGATCGCGTTGACAATCCCAcATTCCcGAGCAATGACATtGGTTGAGAAGCGCAACTTCACgaCATC
TTGCCGGGCATGGAACCCAAAGAGCGGTGTGTGGGACTCGGATTCCTGCTTTAAAGACGACGCGACCAGTTCATTCACCTCCACGGTGTGCTACTGCTCT
GAAATCACGTCTCAGTTGGAAGTTTTAGTCACTCTCGAAGAGCGTCTCGATTACTACGCACTTTCaGATGAACTCTACCGAGACGACGAGCCTTCGATCG
TCGGTACCGTGTCcACGGCGGTTCTCGTCGGGCTGTTTATAGTTGCAGCTCGTGTTGGCCAGCGCGTCGATACGCGAGACGACCAGAAAGACAAAGAtAA
GACCATTAAGAATCTCAACAGGAGCAAATGGAGCGAGCTGCAGGAACGTGTAACGGCGGCAGCGGAAGGAACTCTGCTCGAGgACTTTGCGACGTATATG
GCCAAGCGAGAGAAAGCACGCGAGCCCATGAAGGTGATTCGCATAGAAGCCAGTGGAACGACAGGGCCCGCAACATCCGAGTCGCTTCTTCcAACGAACG
CAATGTTGGCGATGCTTCCTCCGGTCGAGACCATCGAAATTCCCAACGAAACGCGCGTTTTGTTCCATTCAAGTGCGTCTCTCCACCGTCACTTTGCAAT
GCTCATGCGGCTGCTTCGAGTTGCGAATGTTGTTCTCCTGATCAGTGGCATTGTCTATGCATTTGTCGGAGTTGACTTCTATCTCGTTCTGGGCAACAGT
ACGTCGGCTGAGCTTGTTCTCTATCTTTATGGGAAGCCTATCGGACTCGTGCTTCTCGCTGCTGGTGGTATTCAAACTCcTCTTGGAGTTTGGGgCATCT
TGTTgaGTCGTCACAACAACTCGGACTCGTCTTCTCGACTGGCTCGTTCCTCGTACGGAGCCCTTTTGCTAGTtATTTTGTTCAGTCAGCTCTTGgTGGT
GCTGCTGTCGTATCGATACGTTCATGATCTCCACGAACTGCCTTTGGCTGGTTTGGAGGCGCTTCAGACCGTATGGAACAACCTGTCTCCCGACACGAAG
ACCGAGATCCAATCGGCGTTTGGCTGTTGTGGCTTTGTGACGATCTCCGACGCTGTCAATGGGTGTCCCGAAGAAGCTCTCGACGCCTCGACACCTCGTA
CGTGCCTCAAAGTGATTGAAGCTCGAGCTAAAACCTTGTTCACTTCTTCGTTCGTATATCTGGAAGCCGTCTTCTTGACGCAACTGGTCGCGTGGATTTT
GATCCGCACGCTTCGGACGTGGCGGCGTCTGCGCCTGCAACAACTaGCTGGAgAATCTGCCAACTCTCCGTCCGGCGAGACGGCATCGGATCGACTTTTG
ATCGCGTCACTgtGGGATGTGATTCTGTACTGCTCCTTCCCATCCTTGCTTCAGGTGCTGATGTGTTTAATGCTCGTGGTGTtACTTTTCGGCATTGATC
TTCTCATTGGGCTGCACATTCTAAGTAACGAAGTCGTTGGTGGGATTCTCGGTGCTGAAGCAGGATCGGTCCTTGTTGCGTGGGCTTCGGTGTATTtACT
TCtGCtcGGCCAGTGTCTGCATGGCGTCcAAACGCGCGATAGCCGACGCTTACAGTGGTTCAACGCGTTTGCTCTCGTCTGCCTATTGGCATCCGTTGGG
CTCTTCGTCTTCGTCAAGCGCATCCGAGATCACTGGCTACTAGACCCTGCGAcTGTCGACTTTATTCACGCCAAATATGTGCAGTTGACTCGCGAGTCGC
TGGTCAGGATCGAAACTCAACTCGacTGCTGCGGTTTTGACTACATCTCTGAAGGCTCCTGCACATCCCTCCCTTCTGCTGATGATCAGATACTGCCGAC
GTGCCGGCCGCAGGTTCTCCACGTGCTTCAGCAAGAGCTTTCTGTCTACTGTTCTCGCTTGACCGCGTACCTTGGTTTCCTAGCCGCTGTATTGTTCCTT
TCGGTGGCTGCTACCCTCCAACTgCgaCGATTTTCCGTCAAGCCTCGGATCcATCCAGACGTGTCTCGACCTGAAaaGCCGTTTGCCTTCCGTTCATTtA
CTCACgggTTGATCAACCGCTTGAGCTGTGTGGTTGTGGTCGTCACTGGCAGTTCTGCGTCGGTCTTCGGGTTGGTCGTCGTCTGTGCTGGCTTGGACGC
CATGTACCAACTCAACGtgCTCCATTTGTCGTATcTGCTTCGCGTGTTTGATCGCCATGTGACGACTTACCTGTTCGCCTTCGGTGGTGTCGTCAGTCTC
TTtGGTGGCTtGgCGCTGGCACTGGCGTGGACGAGACGCCGCGTGCTCGCATGGGCGTTTCTACTGTGCAGCGCGACGCTCTTTGTGTCGGCGTTTGCTC
TCGCTGGGTTCTCCTATCGATTCGCTCACAtGCCCACGAACGACGAAGCGCTCGACGACCACCTTCGGTCGTTTTGGATCTCGACGCCTCCGCAAACCAC
CCGtGTGTtCCTCCAGAACGCGCTTGGGTGTTGCGGATACGCCAAAGTGGAGCGCGCGAATGGCACCGTTaTGTACACGGAGGCAGCCGAGCGCTCTGCA
TGGAAGTATGAGAACGcgATCGTTGAAACGGATGTCTATCGGCCACTGGACAACGCCACGAGCCAGCAGAACCGACGACGCCTCAGTGTCGTCAGCCATA
CGTCTCGAAGACTGACTCAGGTGGTGTGTCCACTCAACGCGACCGAGGCGTGTGCTCCCCAACTTAAGGCGTACGTCAAGCACAcAGCCTCTCGagCCTT
TCagCTTACTGTAGGGCTCCTGCTCACGCTCTGCATCCTGATGGTTGCCGTCTTCGGTCTCTTCTGGGAGCCCTTCAACCCTCCGCCTTCTGAACCACTG
CACGCCAGTACTGTAGCTGCCCGTGGCATCTTGCTTTTGGTCGCTGCCGCTTCCCTGTTCCTCTCACTCGCCAGCTTCTTCCTGGgTCTCGACGTCGTGC
GTCACTGGTCGCTCTTCAGCTCGCCTCTgCTACAGTTGGTGTTTCCGCACTCGATCGGCATCGCGTTTTTCATTTTCGCGCTCTACCTCGCAGCGTTGAA
CGCGTACACGATCCACGGCGTCTTCGGCAGTGTTGTCCACCGAGTGTTCATGCAGTGCcTCGGTCGGACACTCTTGATCCTCTGTGGCTGGCTGTGCGTC
GGACTCACCGGCTACGCgTCTCATTTCGGAGGTGGCTtGTGGCGGAGCCATTTGCAGTCaTTCTTGGATCGTCAATGGGACACGCTGAGCCCACCCATCC
AGCATCGTATCTCCCTTGAGAACCAGTGTTGTGGGTTCCACGACCCAGTCGTCGTCAAGAACAAGGGCATCGTCTTCGACCGTCCAGCCGTGGGCTTCAC
GTGCTCTCTTAGTGCTGCAAGCGGGTGTCGTCACGCGCTCGAGACCCAGATCGGAGGCTCCTTCGGGTGGTTGTTCCTATATTCTCTGTCGTTCACGCTC
GTCGAaTGCCTCGCGCTGCTGTGCAGCTGGGTCGTGCTGGCCCACTTGAGGACCGTGAAGCCACTCGAGTGGTTTGTCATCGAGAGCCGCCTGCGGTTTG
CTGCTGGTAAATATCGTGGGGAATTGCGTCGCAAGCACGTCGCGATCTCGGTCGCCACGCAGTTCGACCGTAAGCtcACGCGGCCGCAGCGCCTCATGAG
TGTGTTGTGTGCAGTGCTCACAACGTTGGCCATCTACAGTGCTcGGTTCGCACAGCGTGGGTGCCATCGCCATGCTCTGAAGACGTGTCAGCAGCCAGAT
GCgTGGGGCTACTTGGGCATGGGCTTGTTGTATGGTGGCGTTGTCGGCTACGTCGCGCAGgTGGCTGCCTGTGGGCTCTTCGAAGCCGTGCGAAATCGTA
GtGACGACGAGTCTCCGGAAGTCGCTgTTGCGAGGCAGCgCAAGGAGAAGGCCCTACTGTTCCGTGGAGTCTTTGGTCGCCtcACTGCCAAGCCCTTTTC
CAGCCTCTCGATAGCCGACAAAGCAGCCGTCCAACcGTCCTCGTTGCTGGAGCCATCAGTGCACTCAACAACAGAGGAGCGTTGGTACACGTGGCTCTCA
CGCTTCTGCCACTGGTTGTACTGCACAGTGGGCGTTGTGCTCTTCCTcTTTGGGTGTGGCTTCGCTACGTTCTTGGGGCTCGTGATGTTCGGTGTCCGGG
gATCGCTTCATGGCGTCAAGTTCGACCAGGGCCCTCGCGAAGGCCTGATCTACAGTGTGCTCTTGGTAGGGACGACTTTGCTTGCGTGGCTGGTGATGGA
TCTCAAGACCAAGAAGAAGGGgATCGGAAGTCGCAGTGGCGTCGTGTTCgTCGCTGtcGCCGTGGCTGCTATCGTCCTCCTCGTCGGGCTtaGCGTCGCC
GTCTTTATGGCTAGCCAGGCACTTGATGAAGACGCGAGCAACTGGACTATTCGAAACACGGGCTTTAGTGTTCCTCAACGCCtCcAAGCGGCTTGGAGCA
ACGACAACTCGGGCTTCTACCGACGGCGAACGCAACTCGAGTTGCTCTGCTGTGGgTTtAaGAaTGGATCCGACACTGCCTTCCGCCCGTGTCCTCCCGG
TACGACCGTGCAAGTGGACTACGAGGCTGTGCGAGTGGATGGAAgTGTGTTGACCAAGACGAAAGATGAGCAACGCGATCTGGATGGCTGCTATGCTAAG
ATGATGATGGACTTCCACTCGCTCGTGGACACGGTGGCGTACGTGGCcGTCGCCGTGGCCGTcGCACTGCTGCTCTTGATCATGACTGCGGTCTtCCTCG
CACGTGAGGTCGTCATGGCCAAGGACGCGAAACTCAAACTgCGCATTGCCTcGACCAGTGCATCGCCTACCGAAGTACGAGAGACGTTCGAGAAGGTCGT
AGGGCTCAAGATCGCGGCGCCGGCGCGTGGCAAGATCCTGTCCAAGATGCTGACGACGAGCTTGGAGAACGTGGCGCCGCACGTGGTGACAGAGCTCGCG
ACCGAGTCGCTAGGTGCCATCGCGACGTCCACAATGCAACTGCCCAATGGCCAAGTGGTCTCGTCTTCTCTGTCTCGAAACGCGTGGGATCACAAGTCCA
AGTTGGGCGTCGTCCCGACAGTCGAGAACGTGCCATATCCGGCGTGGGTCGTGCGTGTTATCTTCACGGTGTGTGCCGCGTGGGCTGCGGTCATGTGCTT
TGTGAtcGTCACCAACTCGCTGGAGCTCGGCACTGGCACGGCTTGGCGATGCATTGGAGCATGGGGGCTCGGTCTCTTCTTCCACTTGGTTGTGGTCGAG
CCCTTCACAGTGTTCCTCCGCATCCTCGGGGCCACACTTGGTCAATGGTGGAGTTCTACCATGGTCTCTCGGCTCTGGCGGTATGGGCGCGATgTGCTGC
GCGTGAAACCCAGTGCCGAGACTCTGGCCCAGCGCCACTATGCGTCTCTCAGTCTCTACGAGCGCATTCGCTTCAATGCGGCCGTGaGGATCCAACGACG
TCTCCTCACGCGACTCGCACGACGCCGCTTCTTGGAGAACGTGCGCGTGAATCGAGAACTCGCGCACCGCGAGCTCATCACGAAGCGACGGTTGACACTC
AAGCAGGCGATCGACGGCTTCTCGACTGAAGAGATCGACGCCTTCCGACTGCTCTTCCACGATGCCGACACTGCTCgTTTGGGGCTTGTTTCCTACTCGG
TCATCTCCCAGTCCATCTATCAGCTGGGCGTGCACGTGGATGCTGCTCTCGTGCGCAGCTTCCTCCTGGAACTCGACCCAGCGTACGCAGACTTGGTCGA
CTTCGAGCACTTTTTGtATGGCATGCACCGCGTGCGACAGCACCACCAAGAAGAGCAGGCGGCCGTCGAAGCTGCCAAGGCACTGgCAGCGGATGAGCGC
GAGGCGGCCAAGGTCGCGGCCGTTCAAGAGGAGTTTGTGAGCTCGTCGACGCGGTTCGGACCCATGGCTGACCCGCAGTCGCGGATCTTCATCAAGCGTC
AGAACCTCATGCGAGAGTTGCGTGAGAAACGTGACTCGCTGCCGTACAAGCTCCTGAGTAAAGTTGCCAAGCTGCCACCGATCCTCCAACGCAGTCAGAC
GGCGACGGGCAGTCCTGGTGGGGCGCTAGTGGAAGACGCAACGCCATCAGTGGACGACAGTGCCCCAACTGGAGcTcATGTGCTGCTTCAGAACCGCAAA
CTATCTCCCAAGAAGAGAGCGCTGGAGATGATGCTCAAGAGGAtAAGTCGAGAGGAGAAAGAGCGAGGGAAAGTCGAGGCGTCGCGATCACCCAAGAAGA
TGATGACCATACCGACGCTGCGGATGACCAAGATACCGAGAGATCGCAAGAGCGAGGGCGTGTCGCTGCCTGAAGCGGTGGTTTGTGCAGGTATCCCCGA
GGGCAACGaGgCAGAGGCACAGTCGCCACTGAAGTCGATTGACCGAGATGCaCCAGGCGTTGATCATGGTGATGCCAGCAGTCAGTCCGGTTCTCCTGAC
GACGATGCCCcGcAGCCGACGACGTCCAAACCGAAGGAAGACGCcGTTCCGTTTGGAACGTTCATGCTCTTAGCCAAGCAGGCACCGAACACTGGGAAGA
GCCGCGTCATGGAGAAGATCTTCCAAAAGAAACACGACGCCAAGGCGAAGCCGTCGACGGATGGCGACGAGAGTGACGACGACAACGCAGAACTCGAGGC
GAGCGACAAGGCGGCAGTctCGAGACCGGCGACGTCCGATACGCGCGAGCGAGTAAGTGCCGTCAgcAAGAGCAGTCTCGAGAAGGCCCTCAAGAAGAAG
GCaCAGACCAAGCCACGCTAAGTTGCAGTGCATCCcTATCttCCATATGTTGtttGTCCATNNNNNNNNNNNNNNNNNNNNTGTCTTGttttCttAGTCG
GTCTTCGTActttggcggcgttacacggtaCGCTCTTTGGCGCGTGTCTGCATGACGCCATGGCCATCACTCCAAGaCACACGCCACCATGGACGTGTGT
GGCGATCGCCAGCCCGCGCCGGACGCCCCGcGCCGCGCCTGCATCCCGCTCTCGCACAAGCGCGTGCCGACGGAGATGCGCGCGCCCGCCGACCATGCGC
ATCTGCTCTACTCGGCGCTGgTGGCTGATGATATCGACATCTCAGCGCTGCGTCGCCATCtCCTCGCACTGCCGGAGGAGCAGTGGCAGGAAGCGTACAA
CCGCACGCACAACGTCTACTTCCAGCGCCCGTTCCATGaCAAACTGGGTGTTAACAACATCATGTGCGTGTTCTCCGACACGCAGCTCGAGAACGTGTAC
GAGCTGCCGCTCTACGCCACCTATCGGACCTTCCTCGAGCCCATTTTCGACCGCATGGGCGTGCATCCCGACCAGGTCGTgCGTTGCCTGTTCGCTCGCA
TGCCAGGTGAGACGCTTATCCCGGCGCATCATGACAATGGGCCgTGGGTCAGCAAGACGCACCGCATCCATGTGCCCATCGTGACGTTCGCCGACGTCGA
GTTCAAGAGCGGCGGGTTGGAAGAGACCATGACGCGGTACGCGTACAACGAAGGCACGATTGTCGAGCTCAATAACGCCGCCAAGCATAGCGTGTGGAAC
CCGTCaCCACGTCTCCGCATCCACCTCATCTTTGACTACGTTGAGCAAGCGCAACGCCTCACGCTCCAGCGCCACGTACTCGCCGCGGGTCAAGTGTGTC
GTCAGGTGCGAGGTCGTGTCGAGCTGCTCACTAGCGCAGTGGACAAGAAGGAGCGAGAAGAAAGCAAGCGCAAGGCCAGTAAGCTGCATGCGGAAGTGGA
GGCACTGGTCAAGGACCAGGTCGGCGCCGACGCGGCGTCCAAGATCGTGACAGCGTGTCGTCACTACTTTATCGAACAGATCAACGCCAAGGCGTTCGTC
CGCGTCGTCCGCCGTGTGCTGCATGGTCAAAGTGACGCCTTTGCTGATAGTGTATGGGCCAAACTGGTCGAGATGTTTGGGTACGTCGACGGCCTGGCGA
AGGAAGAGCTGCAGGCGGCCTGCCGAACGCTCGTGTTCGCACCCAACTGGGTTATCATTGGTGCTCAGAAGTGCGGCACGACGTCTCTATACGAGTATCT
GAGCCAGCACCCaCAGGTGTTCAAGGGTAAGCGTCGTGAGCCTCACTTTTTCGACTGGCAGTGGGAGGCTGCCCTGAAACACAAGCTTtCCGCTGAAGAC
GAGGCCACGTACAAGCGCATCCTCACCAAGTTCGCAGCCGCTCGACGAGCGCAAGGATCGGGTgAACAGGAGGAGCTGGAGGACGACAAGCTGGAGGAAC
TGCAGGGGAACAGTCTGACAGACATGCGGTAAGTTGGGCCCTACACAGGCAGGGAGGagTCTCGTGGAAACTGACGCTTGTATCTCTTTGACCGTCAGAG
CCAAGTACTTGGCGTCTCTACAGTGCGAAGACCCGGCCGCGGTGCTTCTCCCACCGATGCAGATCGGCGAGTCTACCCCTAGCTACCTCCTCTATGGCGA
GCGCGTTGCCCGACGTCTGTATCAGGTGAGTCCCCTTAAGAGCTACACCATCTCTTTGCCTAGAATGCTGGCTAACAACACTTCTTCGTGTAGCTGTACC
CCAATATGAAGCTCATCGTGATGCTCCGTGACCCTGTGAAGCGTGCGTTTTCGCACTACCAGATGACCGCCGATCCGAACGGCACGGCCCAACAGCTCAA
GATgCGCGAGCCAGTGCGTGGCAAGTCGTTCGAGCAGGTAGTGGAAGAGGACTTGGCGCTTCTGGAGACGCACAAGGTCGCACCGACGCTGCTGGACTCA
GTGGACAGCtCCGTCGCCGACAGCTTCCAGCACTACGCCGACGCGTTGTCCCAGCAGCAcGGTGCGCACTCGTTCGTCGGCCGCGGCCTCTATtCGCTGC
AGATCGCCCTGTGGCTCCGCGTGTTCCCACGTGAGCAGTTTCTGATCGTCGATCTCGACGACATGAAGACGCCcGAAGGCACGCGCCGCGTCGCCAACGA
CGCGTTCGAGTTCCTCGATTTGGtGCCGCACGACGTGGCCGACACCGATCGtAAGAACACGCGCGCGTACGGGGCCAtcGACGACGCCGTAGCTGCGCGC
CTGCGGGCGTTCTACGCGCCCTaCAaCGAGCAGCTCTTCGAGCTGGTCGGCCGTCGCTTCAAGTGGTGATGCGCACATCAcGTACGCGGGTGTAGCCATA
TTGGTTTAGACAGAATACGAAACTAATATAGGGACGGTTGTAGGAGGATCGCGTCCGTGTTTAGTACAAACAACCGGATTTAACGGGACAACGCCTagTT
GTTTGTTGGCGTTTGAGTGCGAAAATGATCGAGGAAGAAGAGTGGTCGAAGGAACAGGAGGCGAACCGGAAGCCAGGGCAGAAGCACCCGACGCCGTCGC
CGGTGCGTGGAGCGAAGGCAGGGGGGAgAGACTCGGTCTTAaGAGGACTCACGATGCGCTGCGTGGAAGGGCTTTGCCGACCGCGTCTtCTATGAGAGtC
TGTTGCAGCAGCGGCCGCAGAGCCGCAtGgCCAaGAAatGGtGTCTTGAGTATGGCGTGCTCAAGTGGgCCGAGGCCGAGGCGCTGTGCAAGGAGCTCGG
cGTTCCcATCGTGCGTCCTGGTCACGCTACGTCCAtGCAGAACCTCGTGGTTGACTGACGCCGTTTGACTGTAGAACGTGACGCGGCCGTCCAAGACCGT
GGCGGCAGGCAaCACCAAGAAGACGTCAAGTCGCGGCGGCtCGCGcTCCAACCTCGACAAGCAGGAGGCGATGGCAGCCCAGGAGCTGGgCCTCTCGGGC
GGCGGCTTCGAAGGCGTCGgTCTCTCTACTCTGTAATTTTACATGCCATGCTCCTGCTCTcTGTCTGtCTTGTGTGTGTCTTCGTTGTCCTCCAcGCCAT
GCCGTAGGAGGCTGCGATGTAGTCCAGCACGAGCAGCGAGCCTCGCTTGTCGAGCACTTTGTTGTACTCGGTGCATTGCGCACTATGGATGCAGGACGGG
CAGCCGCTAACGCACACACACTCGCGGGCGATCAGCCGCGCGCGGCGGATGATGGGCGGCAGCGACCGGAGGATCTCCTCCACGAGGCCACTCCCACCCT
CGCGCTTCTCGTAGATGGTGATCCGGTTCGGTCGCACACGTCGCTCAAACGGGTTGTAGTGCTCCGTGTTGATGTCGCCTCCATCACACAGCACGAACAG
CGGCGCCACGGCGAGAAGCAAGTGCCCGACGCCGTGGAGTGCCCCAGCCCAGACGAACGACGCGCCTTCGACcTGGCGCTTGAGCGCATGAGGAAGCTCA
AGCCACAACGCGTGGCCGAAGCTCTGCATGGGCGGCAGCGAGAACTCGTTGGTGTGGATCACGCGCATCGTCTTCTTCTCGAGCAGtGTCGAGCCGAAGA
CCGACGTCGAGACGGACACGTCACCTTCGCATaCAAAGACcGGGTCGGCGTCCGCCACGTGGGAGACTCGTGTGCGGTGCTGCACCTTGACGACGTCCAC
CTCGGTGTAGTCGCGACAGGCCGTGAAGTACGTCAGTGGATGCGCGCTCTTGCGAGCAAACGCGACCTTCTGCTCGACGTCGAGACGCGTGACGATGTAC
TCTTGTGCCTGGTGCAAGTACACGGCCGTCGGGTAGACCTGGAAAAAGACCATTTCGCCCGGGATCTCGTCCAGTATCACGTGCTCGTCGTCGTCCGTCA
CGACCTTGtAGTTGATCTCGGAGATGCTGCGCAGACTCAACGCCcGGgTCGCTTTCGGCACACACGAGTGCAGTTTGAAGCCACCTCCTTCGCCTCGCAG
GCGCTGCACGAGCTGTTGTCTCTCGGTGTGTTCTTTGACGaGACGTAGCACCGGAGAAgTGGGGAACTGCGTGTCGAAGATGGaCTCATCGACGTACGCC
AGTCCGGAGCGCGAGTCGAACAGCGGGTACTCGTGTGCTGCACACAGCAGATGCGGCCcGACGATCTTGGGGTTGTGCGGGTTTAACGTCACGGCCTccg
gCGTGAGCTCGAACAGTTCCGTCGCATGGcgggCAAAGTGCTGGTCGAGTGGGGCGTCAAAGCACACGATGACGGCGAGCGAGGCGTTGCGGAGCGTCTC
CTTGCGACGCCCTGCACGGCCGGCCTGCTGCCACAAGGACGAAATACTGCCTGGCAGACCGAGGTGCATGGTCGCGTCCAGTTCCCCGATATCGATGCCC
AGCTCGAGTGCATtCGTGGCGATCACCCCAAGCAGCTCGCCGGAGAACAGACGCTGCTCAATGCGGCGACGGTCCTCagCCGTGTACCCTCCACGATACG
TGTGCACACGCTTGATGAGATGCTTGGTCTTGGATGAGTCACTGAGTACGGAATGCACAGCCATGAGCACGAGTTCCGACAGTTTGCGGCCcTTGCAGAA
GAGCAGCGTGTGCACCTTCTCGGCCACCAACGCTGAGAAGATCTTGGCGCTTTGGTAGATGGAGCTCGTGCTGTTGCTGTGCTTCGCCGCTTCGTCTTCT
GTCGCATCACTCTGCTCTCTCTTCCGTTTGCGGATGCTCGTTGTCTCTTGGGCTTCTTCGGA