Description :
From Genome Similarity Track
Location :
Scaffold_1528:212- 5979
Transcript NameFunction/comments
Phyta_totarag13195hypothetical protein

Sequence
5767 bases(100 bases per row)
aaaTCACACTAGCGGGATCTCTAGTGCATTTCTTCGATGTCTGGGTGGGTGATCTGGCAGGCCAAGATGCTATCCTAGGCATGGAATTCATGGTACCGGC
TGGATCTGGCCGACGGGTCAATCTGCTTGCCGGACGAAGTAAAGATCCAGCTtagtggacgacgacagctccgcAATGACAAAGCGAGGTTCTTGAGGGT
AGGTCAACATACGCAGATCGGCATCGGAGAATCCGTGGAGCTACGAAGGAGCCTCAGATCTTCCAATCAGGAAAAAGTGTGGATCACTAGGGGAGATCGG
TGGGTACCCACGGTGGTCAGCGGCTCCGGCAAGTCAAGATAACTGCAGATCACGAACATCAGCGACAGGAAACTGATCCTCCAAGGTGACGAACGAATCA
GGATGTGGCTGGCAGGAGATCGAGTGCCACGCGTCCCAGGATTCGTCTCTATTGGATCCCGCCGCTATAAGGAATGGCAAAATCTAGCCCTAGAAGCTAC
CACAGAGACGAGATCGGAGGAAGACCAAACGGTCGACGCCGTTGACGGCCCTAGTGTACATCGACCGGAGTACCCGACACCTCGCGCGATATTACGGAGA
AGTGACACTTCGCCGACCCAACGTACATCGATCGGGTTGTTGAGAACAGAGCCCAGATCGGGCACTACGTTAGGCGACCAGGCTTTGTCTGGAGAGGCGA
CGTCGGCGTTGCCCGGAAGCATCCCGGCGCAAGTGGACGAGCTTTTGGGGCAGACGGATCAGGCGATAACAGGGGCATCAAAACCAGATTTAGAAGATAA
TAAGCCACCGGGATTAGATCTGGTACCGGTATACGGGGATACATCGAGCGAAGTGGATCATCGATCGCCTACCCTACGGATGGCGAAGTTGCTCCTGACA
GACGTGCCAGCGACAGGCCCAGCCCCCAGGCTGAAGCCGATAAACCACTCGAAACAAGTTGATATAGATCGACGAAAAGAGGAAGATCAGGTTGAAGAGG
AGCAGGTCTGTTACCACGAAAGCGGAGATCTGCACGCCGAGGAAGTTCAAGGAGAGATGGCAGTACTCCCAGAAGTCACCCTGAATACGGATGAAGGTAC
GATCGACGATATCCAAGTAGGAGATCCGGCGTTCAACTCTCTGGAAGAGATCGATTGCCTACGTCGGAAGATCTGGAAATATCGACATCTGCTCATCGGC
AAGGGTAATACCTTACCACCCGCTACCAGAGATGTTGTATGCGGCATCGATGTGGGAAACGCTAAGCCGATCGCCCAACGCGTGAGAAAGGTGGCCCCAC
AGTTCCGGGAAAAGTTGTCAGAGCTGATCAAGGGACtgctcaccaccagcatTATTCGCCACTTGACGTCTCCTTGGGCTTCCTCCATAGTGGTGATCAT
CAAGAAAAATGGAGTGGATATACGGCTGTGCATCGACTATCGACTGGTGAATAGCCTTACAAGACTTATGGTGTATCCGATGCCCTTGAACAACGACCTC
TTAAAAGATCTGGACAAGATCTTGTGGTACTGTTCGCTTGACATGGCGAGTTGGTTCTGGGTAGTTACGATGACGGACGGCGCCCGAGCAATTTCGGCCT
TCACCACGCCGTTTTGCTTATTCGAATGGAATCGGATGCCTTTTGGCCCCAAGAACGCTCCTCAGATCTACCAGCGCCTACTGGACAATGCGTTGTACGG
GTTCACTCGGATCTCGCGTTCCGGTGACTGCCAAGGGATCACGGATCTGTTCGAAGACGGAGAGCCGGACGATCCGAGTCAGCCGTCGGTATTGGGACGC
AGATCCTACATCGATAACATCCTAGTAACTGCCAGATTGTGGGATCAGATATGCGATCGAGTAGACGCCCTTGTGATAAGTGGGATTTGTCGATTAGCGT
GGTCAAGAGTTTCTGGGGAAGGCACAACGTAGACTATCTGGGACATCAGGTGTTGAGTGACGGGCTTGAAGCCAACCCCAAGGCCCTGGAGGCGTTGACC
GGTCTACCCTTCCTGGGAACACTCCGAGCCATGCAGTCTTTCCTGGGTAGTTTGAATTACTACAGCCGCTTCGTCGAAGACTACGCAATTTATGCAGCGG
TGCTGTGTGAATTACGGGAGGTGGACTTTGCCgcgctgacgaagaaggggAAGCGTGAACAGATCGAGAGCCTGCTACAACTCCCTGATCCGGATCTGGA
CCAACCAGACCCAAGGACTGAATATCTGGAGGCGAATGGGTTCGGCCCTCGAGATTGACAGGTGTCGGTGGTAGACGAAATCGATCCACAATGGATCCAC
GCTTACCGAGCTTTTGAGGTCTTAAAAAAGAAAATCGCGAAGACCCCGATCTTACGGCACTTTGACCCATAACGTCaagcggtggtggtcgtaTACGCCA
GTGACTGGACGACCTTGGCGGCTCTGATGCAGGATCACGATGGGACGCATTATCCTGTCATCTTCGCAGGTCGAACCCTGAAATCAAATGAGCTGAACTA
CGGAGTGGTCGAAAAAGAAGTGCTGGCCCTGTTGCGGATCTTAGCTCTGAACTATAATGTGCTGGTGGGACGACCAATCCGGATCTTGACCCGACATTCG
ACGTTAGTGTGGCTCTTCCAGTCTCCGGGACTTCAGGGACGATTAGGGCAATGGGCAGCACTGCTGTCGCCGTGGACACTCGATATCACGAAGTGTACGA
AAGGGGAGGATGAAATCCTGGGGGCGCTGGCTGCCTGCATAACCCCTAGCTCGGACGTGGATAAGGCTCTGATCTCGATCGCGCCAAAAAAGGAACCCCG
CCGTCAGATCCATGCCCCGATCCCTACCGTGAGCttggaagaagaactccTTGTAGAGAGCTTCGACGGATCGGATCGGGTAAGGAGGCGCGTTCAGCGC
GATCCTGTGGAAGTTACCGGAGTGGACAGTTGTCAAGGCCAGATCTCTCTATGCCGAATGCTTAACAGTGAACGAGGCGGAGTACAACGGCCTTCTGTTG
TGTCTTGATCTATTGGATGGGATGGAATACCAACGTCTCGTGATCTGTGGAGAGTCAAATCTGGTGATCCGTCAAGTTAGAGGTGAAATCGACTGTAAGG
CGCCTGGGCTGAAGTTCCTGAAGCAAAGGGCACTGGATCGGCTACGGGCTTGGCCCAACCATGAACTGGTACATGCGAAGCGGGAGTGGACTAGCATCGC
TGACAGCCTGGCTAGTGCAGCACTCCAGCGAGGAGAAGGGGTCGAGGTGACGAAGGAGTCTAATAGACAGAACCTGGTTACACTAAACCGACTAGACGAA
ATTTTGGTTGTCCGATCAGAGGACCTAGTAGGGAATATCTCGCCGGTCATCACCAGATCTCGAAATCGGCCCAGATCCAACCCCGAGGTATTGAGAGAGG
AACTCGTGCGAGATCTCAGGATCGACCGGATCCGTAGAGcacaggacgaggaggcgtAGATCTCTGGGCTGAAGAGATATTTAGCCGGAGATGTACGCGG
TCTGGATCAAGCGGAAGCTAGATCCTACAGTGGTATTGCTATGGATtacgaggtggacgaccagGATCTACTATTTTactgcccccccccctcctaAAAG
ATCGAACGCAGATCGGACTGGATTGATGAGGCTTGTGGCCCCAGAAACGCCCCATCAGGATATTCTACACCGCTATCACGCGAGTATCGAAGGAGGTCAT
CAAGGGATAGGGCGTACCTACTTGCGCATTCGGGATCATTTCCATTGGAGAGGCCTCTACCGGAGTGTGCAGCAGTATGTGGGGAGTTGCATCGATTGTG
AGACGTGAAAAGGGAAACCGACGATCCAAGGTGAGTCGCCTGGAAATATCCAAGCGACCTACCCGTTCCAGATCATAGCCATGGATCATATACCTTCGCT
GCCTAAATCATACAAAGGTAAtacggagctgctgctctgggtAGATCTATTTACAGGGTATGTAATTGCTAAAGCTAGCGCGTCCAGGACGGCTCAGACA
ATGGCCGAATCTTATGAGGAATGTGTTTTCCGTTGGTTCGGTGCCAGTGAGGAGGTCCGGCATGATCGGGAGTCAGGAGTCATGTCCGAATTTTTTCGCG
CGTTCAACAGGATCTTGGGACAACGGCAGCGTGCCACAATGGCCTATCGACCCCAGGCAAACGGAACAGCCGAACGTATGGTGCAAACGTTAACTCGTGC
ATTATAGATGTATGTACAAGATCTAGAGCAGCAAGACTGGGACGAATATGCCGAACAATTGACGTTCGCGATCAACACGGCCCAACACCGGATCCGAGGT
GACACCCCAATTTACCTGGTACACGGATGGGACCTCGGATCTACGTTGGAGGCCACGATCCCAGTAGGCAGCACTCGACGACAGGATCGAGATCCACGAA
GATGGCGGTACCAGATCCAAAAGTATTACCGGCAGGCGCGAGGACAGGCCAATGAGAAGTTACGCGAAGCCATCTCCGATCGGGCAGATCAACACAACGA
GAGAGCTCAACCCCACCAGATCGAGGCGGGATCGCAAGTCTGGCTATATCTAGATCGGGTCAAGGAAGGATACCCACGTACGCTGGCGCACCTGTGGCAC
GGTCCGTTACGAGTGACCGATCGGACCAATGTCTTCACCATGAAATTGGAGATCGCAGGTTCTGGATATCGTCTATTTCCTATAGTACACGTATCTAAGC
TCAAGCTGGTCAAAGCGTTTCCAGATCGGCCGAAGATCTGACTCAACGTCGAAGACGGAGACTGGCTAGATCTCGATGAAGCTCTGCTGCCAGAAGACAG
CTGGATCCAGGATCTAGAGGACGATGAATACgaagtggaggagatcgtcgaTATGAGGACCGGCCGAAAGACCAGATATGGTCGGATCCTCCGAGAGTTC
TTGATGAAATGGCGGGGATATGAAGATCGGAGCTGGGTGGACGAAACCGATCTTAACTGTGGTGATCTATTATATGAGCTTTTACGAGGTCGCACCAACC
GCTACAGGTTCGAGGTAATGCAGTCTCACGAGGAGTAGCCGGGCTGTGACCGATCAGGATGAGTTGGTCGTCCTGATCGGAAGAGTGAAGAAGGATCTGC
GAGAAGGTCGCAGATCGGAGGAAAGGGATATGCatatatacatgtagactcAACATGGGAGACCAGACCTTCAAAATCAGATCGAGATATTAAGGGAAGC
TATCAAGTTACGCTACGGTCACATTACTAGAGTCAGGACCGGGAGGCGGGCGAAACCCAGTGGCAGATCCAGACCGAAGGGGAAGAAGTTACTCAAGGGG
AGGGCCGTCCCGGAGCTCTGAGACACGTTGAAGAACTTGCCAGGCAATCGCGAAATCCGGCGAGATGGGTGAAGATCCGGAGTGTCCCGGTAGTGGTTAC
GCCACGGATCGGCATCGTTACACTCATCCAGAGCCTCCAAGAGATCCGTGGGCTCGACCCGGTTCAGAGTCGGATCCGCCAAGTTGGCCGACCGCGACAC
AATACCGGGGTACTACATCACTGACTCCGTCCGAcggaggaagtggaggatGAAGGGTCCAATAACACGTCCAGATCACACCAGTTCTCCCGCATGGCGG
TGATCAGGACCCAGACCAAGCGTTTTCACGCGCTCCCTGCGTGGGAACGACGGTTTTTCTGTTCCTTCCAGAAATAGAGAAGCCACGGGTCCGAGTCTCA
TAGCACCGTGGGGATGGGGAAGAAGTGGGTAGACTCCCAAAAGGCTTGTAGGAGACCCGCCTCCAAC