Description :
From Genome Similarity Track
Location :
Scaffold_989:212- 5098
Sequence
4886 bases(100 bases per row)
AGATCGTCTTCGCTGACCCAGCTAGGctCGTCGTAGCCTTTCCATCGTACGAGGTATCGCCTCGTGACTcGCCCCTGACGAGCGGCTCGGCCTATTTCGT
GGTCCAGGATGGCCTCGATCTCGTAATCACCGTCGTCTTCGTTCGGCTCGAATGAGTCTtCAGGCAAAAGGGCCTCGTCGAAGTCGAGACGATCCTCACT
AGCCAGTTCGAGTTCACCTGTTGGCCGTCCACTATACTCCTTCCACAAcTtCAGGCGAGAGACGTGCACCACGGAGAAgATACGATAGCCGGTTCCTTCG
ATCTCGAGTCGTACCACGTGATCGGCAAGGCGTTCCAGCACCCTGAAAGGGCCGTGCCACAGGTGGGtGCTCTTCTTGGCATATCCTGGCCTCACTTGGT
TCACATACACCCAcACTCGTGCAcaTTCGACGATCGCATCAGCATCTCCTCGCCTCTCGCTACTGGCTTGAtcACGTCGTTCCTCCATAGtcGCACGTAA
CAgTCGGTTGACATCTTCTCTGGCCCGCTGATACTGAGCTTGAAGACTtGATCTCCACTGTCGAGCgTCTCGGTGTCGTCCTCGCCcTTCCGCTGTCGGC
AGAGCCACTTCGATCGTCGTCCGTGGTTCCCACCCATGAaGCAGATAAAaCGGAGAATCActCTTtACCCGATCGTAAGCGGTGTTGAGAGCTAGGGTGA
TGCGTTCTGCATAATTATCCCAGTCTCGCTGTTCGGGACCTGAGACGTACTTTGACAGCGTTTGTGATCGTCTGCACCATTTGCCCCGTCATGCCGTTCG
ACTGCGGGCGATAAGCCGGAGTCGCCTTGCTAGTGCCCCGATGAGCCGATTGAAGCACCGAAACACTTCTGACATAAACGCAGGCTCGCGATCGTGTCTG
ATGATCTCGCTcGCCCCCAATCGCCTATAGATAGCTCTCTCGTAGGATTCCGCGACTTCTTGGGCTACTCTGCTGCGGTTGGCGCTGACGATCACGAAGC
CTGTGTGCTGATCCTCCCAGATCAGTAGCTCCGAGTTCCCCCGATGTGACCTTGGCAGCGATGGTATGTGGTCCATGCCGATCATCTGGAATGGTCTCGT
CGCTACAATATTGCCGGGgTTGGGGACCACGATTCGAGGTGCTCCTTTGTCTGATTGGCAGTCGCTACACGCAGCCACGTAGTCTTCTCACCCCTTGGTG
ACCGCCATTCAGACTCGCGTAATAGTGACAGAGCGCATCCTTCCCCAGCGTCGTCGGAAGAACTAGTCGAAGGCTACTTTCTCGACCGATCACCTCTCGC
GACTTCCGGCTCCCCACGTAGTACAGCAGATCATCGACGACCTCGTgaTGATTGGCCTTCTTCGACGCCTTCTCTGTCgtACCACCTGTTAAGTCTGCGC
CTTCGCCCGTTATCCACTTCTTCAGATCCCTGACCCATCTTTCCTCATCTTGCGCCACGCAGATTCTCTCTGCGCGGAGCCGACGGCGCCGCCGCgCCcG
cGTTGTAGGGCCTTCCCTGTGATGAGGTCTGCTGCCCCGTTGTACTCCCGTGAgACGTGAACGAGACTAACANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGACCCGCCAAACAAGATATCGTCAATGTATGATCTCCTTCCGATGGCTGGGCTCA
CCTCAGATCCTGCTGGCTCGCACTTGTCGAACAAGTCGATCTCCTTGTCCTCTCGTAAATGCTCAGGCGTCAGCTTTAGATACCCGTACAGCGTGTTGTC
CAGCAGTCTCTGGTAGATCTGAGGAGCGTTTTTAAGCCCGAAGGGCACCTTCAGCCACTCGAACAGCCCAAACGGCGTGATGAATGCTGAGATTGCACGT
GCGCTTGCCGTCACTTGACAACCCAGAACCCGCTCGCCATATCGAGTGAGCAAAGCcACTGCAGTGAACCGAGGTCCTCGAGTAGATCTTGTACTACCGG
CATCGGATAGATCATCAATCTTGTCAGTGAGTTCACCACTCGATAGTCGATACAGAGGCGGATGTCCACGCCGTTTTTCTTGATCACGATCACGATGGGG
GAAGCCCACGGTGACCGAGATGGCTGGATGAACTGGGACTGTAGCAATCCCTTCAGGAGCTTGTAGAGCTGCTCACTGAACCGTGGAGGCACCTTCCTGC
ACGTTTGTGCAATTGGCTTGGCATCTCCCACGTCAATATCGCAGACGACTCCCTTGGCCGCCGGCGGGCGGGCATTACCCTTCCCCACCAGGAACGCTCT
TCTCTTCCAGACAATGTCTCTGACTTGCTCGATCATCTCTGAGGGTAGATCTTCGCCAACCGCTACCTGGATGTCTTCACGGCGGATCTCGTCACTGGGg
TTtACCTCTCGAATGATGGCCACCTGTCCGTCGCGATCTTCAGCTGTAATGTCGCCTTCCTCGTTGACGAACACTGCATCATGCAACCGGGAAtCTTCGA
CGATCAGCTCCGCGATCGACTTCGACGTCACGAACGCAATGGCTGCTCATGCCCAATACGCCTTATCGTCGCTTGGTGCCTCGGGCCCGCCGCGTATCAC
CTCCTCATCGCCCAAATCACCGGAGACGCTCCTGCCTGGCCGACTTAGGATTGCCTCGGGAGTCGGATACTCACGCTTCTCCACTATCGGGGGGTCgTCT
GCGGCCATAGTGGCAGCCAGTGCTCGTCGTCGATGGCTCAGGTTCGACTTCATACACAAGCGTACACCACTCGTGGTACCGTCGTGAGCCGACCGAGACA
CATCTGGCTAGACGAGGAACTGCCTCGTAACCGAGCCACATTCCCACGACCGTCTGGGCCGATATGAGGGTAGTCTGACTCGATACGTTGGTGATCTTCA
CTTGGATCGGCTTCCCTTGAGCATTAAGCTCTACCGTTGGCACCCATGCATCTCCTCTTCGGAGCCACAGCTTCTTCCGGTTTGGTGGCTTGACCCGTAG
ATAGATGGAGCTTCCCACCGCGAGGGTAGTGTCGCCTTTCACCCGGATCTGCTCGACCTTCTCACTGTACAGGGGCTTCCGGCCCTCGAAaCGTACCCTG
ATCTCGTCAGGCATCAAAGCGACACCTTCAGAGAGATCGAGGCGGATCCCGGCTGGAGTTAGGAAaTCGCAGCCGAGGATCGCGTCCACGTTACCGAGTT
TGCCGACTCATACTTGGCACTCATAGGCTAGTTCATGGGCAAGTGTCACCTTGACCCACGCCTTCCCTTCTGTGGTGAATGCCGATCCTCCAACACCTTC
ACAACCTAGCTGCTCTGATCGGTCGACCTTGATGCCCTTCTTACGCGCAAAGTTGGCATCCAGGATCGAGACCTCCGCGCCTGAGTCCAGTAAGACTCTA
GCGTTGTGACcATTCACCTgaGCAGCGACAATCGTCTGGCGATACAGCTTCTGAGAGTAaTATCTCCAATATCCCCGTTGCTCTCC