Description :
From Genome Similarity Track
Location :
Scaffold_422:212- 3996
Transcript NameFunction/comments
Hyaar_Emoy2814106hypothetical protein

Sequence
3784 bases(100 bases per row)
ATTGTATTCACGTTGCTAAAGGCTAAGATAGCCACAACTCCAATCTTAAAGCATTTCGATCCCGATCGATCGCCTTTGATCGTGGTGTATGCTAGTAAGT
GGGCTGTATCAGCTTCTTTTTGCTTCAAGAATGTGATGGTGTGTATTGGCCTGTCACTTTCTCCAGTCGTACGCTAAAGCCCAACGAGGTCAACTACGGG
ATGATAGAGAAAGAAGTGTTGGCTCTCGTCCGGATGCTAGATATCTGCTATACTATGCTAGTATCCCGTGAGATTACGGTGCTTACGTGATAGTCGACAC
TAGCATGGTTACTATAATCTTCAGGCCTCAACGGAAGATTGGGAAGATGGGCTGCTTTACTATCGAACTGGACGTTGGAAATTAGGCGGTCTGAGAAGGG
AGAAGATGAAATAATCGGCATGCTTGCGCCAAGTGTAACACCTCGTGAAGAATTAGATGAAGTATCGATTGCGATCGCCCCGAGGAAGCAGCCAAGACAG
ACGATAAGCATGCCACCACCCACAGTAGGTGTGAATGAAAACCTGCTGGTAGCCAGTTTCGATGGATCAGCCAGGGTGAAAAGAAAGGGCGGAGCATACA
GCGCGATTATATGGAAACTGCCGGAATGGACGATTGTGGCTGATGCTTTCGAGTATACCCCTGATCTAACCGTGAATGAAGCAGAATACCGAGGACTGCT
CCTTAGTTTCGATTTCTTGTCGATCAGGCAAGGGGACGGGTGATTATCTGCAGAGATTCGAATTCGGTGACCCGTCAAATGCGAGGTGAAATGTAAAGCA
CCGGGACTGCAGTTGTTAAGGCATACGGATATGGAGAGATTACGATTGTGACCATCCCACGAGTTCTTGCACATGAAGCGGGACTGGAATTAGAGTGCAG
ATCGATTGGCGAGCGAAGCTCTACGGCAAGAGAAAGGGACAGTTGTGGTTTCCGATCAAGAGTGTCAGGACCTGATTACTCTCAATCGGTTAAACGAATT
ACTACTACCAGAACGAGTTGATCGTGCGGTCAAAGTAGCGGCTATCACTCGAACAGCTCAGAAAAGACGATGTCAGCCCAGGATTTTACAGGAAGAGGTT
GTACAGCAGATACGGATTGATCGATTTAAGCACAAGACGAAGAAAACTGGATATCTAGTCTGAAGATATATCTAGTTGGAGACGTAGCTAAATTATCGGC
AGCTGAAGCAAAGGTGTGCACCCTGATCGCACCGGACTATGATGTAGACCAAAGTGGGCTGCTATTCTTCTGACCGAGATCGGCCACCGAAGCTGAAGAT
CGTACTGAACTGGCTCGTTTGGTGGTTCCAGAACAGTTACAGCGAGACTTCTTGCACCACTACCACACAAGTTTGGAGGGTGGTCACCAAGGAATCGGCC
GTACCTATCAACGGATCGGGGAGAATTTCCATTGGCGTGGGTTGTACCGAAGTGTGCAACGGTATGTGGGAGAGTGTGTAGATTGTGAAACGGGGAAAGG
ACGGTAATATGCAATCAACGTAATCTTTTTAGATTATAGCTATGGATCACATCTCTTCGTTGCCAAGATCCTTTAAAGGAAACACCGAGCGGTTGCTGTG
GATCAATTTGTTCTCGGGATGTGTGATCACAAATGCAAGCTCGTCCAGATCTGCCCAAATGATCGCAGAGAATTACGAGGAGTGCGTGTTCAGACGATTC
TGTGCGAGTGAGGCGATACGCCATGATCGCAAGCCGGGATTTAATTCTTCCGAGAATTAAATCGAATCGCGGGACAAAAACAACGGGCCACTATGGCGTA
TAGATCGCAAGCTAATGGTACGGCCGAACGCATGGTGCAGACGCTGACTCGATCGATCAAGATGTATGTCATGGATGAAAATCAAAAGGACTGGGACGAA
TACGCAGAGCGATTGACTTATGCGATCAACACCGCTCATGATCGAATTCGAGGAGATACACCGTTCTACCTGATTCACGGTTGGGACCCAAGATCGACCT
TGGAAGTAACCTTACCGTTAAGAAGTACCAAACCCCGTGATCGAGATGCCGAAGATGGAGATATTGTATACAACGCCAATATCAACGTGCTCGGGCGTTA
GTGAATGAACGACTGGAGGTTGCGATCAGAGGTCGAACCGATCGACACAATGAAGATCGAGATTTATTGGATATCGATCGCGGGTAGCGAGTTTGGCTAT
ATCTGGACCGAGCCAGGGAAGGATATGCTCGAAAGCTAGCCCATATATGGCATGGACCTTTTTGAGTGTCCGAGAAGTGCGGCGATCACGCCGTAAAGCT
GGACATCGCGGGCACGCCGTACCGGCTATTCCCAATAGTCCACGTGTCTAAGCTGAAGCTAGTTCGCGTATTCCCAGAATGCCTAACGGGTGGGTTGATT
GTGGATGAGGCGAGTCGGTTTGATTTTGATGAAGCACTGCTGACGGAAGATAGTTGAGAGGGTAATCTCGACGCGGATGAGTTTGAAATAGACAAGATCA
TCGATGTGGTATCAGGACGGAAGACGAGATATGGCCGAATACACAAGCTGTACCTGGTACAATGGAAGAAGTACAGCGACCCAACTTGGATTGATGAAGC
TGATCTAAATTGTGGAGCTATGTTGCAGGAGTTCTATCGCGATCAGGTGAGCAAGAATAGTTTTGAGGTGATGCAATCGCACGAAGAAGAAGCCAGAGAA
TAGCGATGATCGGAGAGCTTGAGTGGATGGGTCTATGCAGGGACGGTGCATGGACGGGGAGGAGAGTTATGGGTGCAAAGAGGTTGCACCTGGAGATGAA
ATGGGATTTATGTGAAGTGATTGCGACGATCGCAGACTTAATGGTGCGATCGAGATGAAAAGACAAAAAAAGATGGAAGAGCTACGAATTATAGGAGCTA
TCGAATGGAAATGAGAAGAAAGTATATTGAGATCGCGTCATGGAACAGACCAAGTAAATTACTTGCGGCCAAAGAACTTACCAACCAAGAGTGGAAGAGA
CGACCCATGGTGGGATACGATCGAAGGACGAAACTGTTTCCTCCACCGCTCGGTAGCGTGATCGATCGACAAAGCAGTGATCAAGTTGGGTATGTTGGTC
CGCCGCACGGATATGCCGGGATACCACACGCTAGCCTGATTCGAAAGTGTAGAAACATGGGGTCCAGTAAAATGTCCAAATCGCAGAGGCCGTCGATCAT
GCCTTGAAGAATCAGCTGCAGTACCCGCTTCCAACGGGGGACAGCACGAGATCGTCTCTGCCTTCTCGCTCGCGCAAAAGCGGCCAATCCAGGATCCGGT
TTACGCTGCTCAGCGGAGATCCACAAGAAATGGTCGATTTCCACATAGCTTGGCGATGGCTATCCACAAAACCTTCATACGCCTCGACCAGTTTTTCGAA
CCAGCCGGAAGGCTTGAAGGAGATCGGGAGTATTATTTGGTCATAAAGGTCCCAAGGTTGTTGATCGTAAAATTGGTCAATCTTGGTCGACGTGATCAAC
TGGGATGACCAGGACGACTCCGGAGAAGAGCGAACTTTGCCCAGTTAGATCGGGAAGATGTATTCCTTGGGCTTTGAAAAGTGATGATAGAACAAGTCCT
ATGTCCAGCTCCGATACGCTGATCAGGCTCACTCTTTGGGCGGACCAAGGGGACACATCTACTGCCTATCGCGGAACCCGATCGCGGGGTATGTGGGTGT
CAGGAAGTGCCGAAAATTCTTCAGGAGTCAGCAGTGAATTACAGGGACTCCGAGAATCACCAGAGAGGCTGAGGTCACCTTCAG