Description :
From Genome Similarity Track
Location :
Scaffold_543:212- 3964
Sequence
3752 bases(100 bases per row)
CACCCTGAATGGTCCATGCCATCGGTGGGCTAGCTTCTTGGTCAGGCCCGACTTGACTCGCTCCATAAACAACCAGACTTGATCTCCTTCTTTGAACAAG
GATTTGGTGGATTCATCACCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGTATCTTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCT
CTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACGCAGCTGCTAATCGAAGTGCACTTCTCGTTGTCTGTTCGCTTCTCGGCGCCACTCGACTACGTCC
GCCGAGTTGACTGGGCGTCCCTGTCCGCGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTGGCATCCCAACCATGTACCAGATAGAAAGGGGTTT
CTCGCCGAGTCGAATCTCTTAAATTGTTGATAGCATGTACCATCTTCTCGGCGATGTCATCCCAGTCGGCTTGAAGTGGATCTTCCACGTAGACCCGTAT
AGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTAGCTTGTGGTCGGTAACTCAGCGTAGCTCTTGATCTCGACTGCATCATCTCGGAGAGC
TTTTGGAATACTTCACTCATAAACCTTGGATCTCCGTCGTGTCGTATCAGAGACGGAGCCCCGAACTGTCTGAAGACGCATTCCTCAAATACCTTGGCCA
CTTCGAGTGCTCCGGTGTCACTCATAGCCTTAGCGATAACGAATCCCGTGAAGTGGTCCTGGAACAGCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGG
AAAAGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAGTAACCTCTCAACTGTGGCTTGCTCTTACTAGTA
TTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTACAGACCAATCCAGTAGTAGTCGGCCTTGACTCGGTGATAAGTTCTGACGATGCCTT
GATGCCCTCCTTCGATCGAGTTGTGGCAGTTATGAAGTATTTCGTCGACCATGGTTGACGGAATCACCAATCTCAAGGAGAGGTTCGGTTCGCCGAGTTC
GCCCAGTCGGCGGGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGCGACTTTGCCGGCATTCTGAGATCGACGGTGTGTA
AGGTCCTCAAATTCACCTCTCAGGTACGCGTTTAGATCGGCCCACCTGAGTTCTTCATCTTGTGCCTTCGCGATTCGTCGCCTCCGCTCAGTCTGTACTG
TCACTGGATCGATGTCGTTGGCATTCTGAGCTGTCTGGGATGACTCTATCTGCGCCCCTGTTTCGACATTCGGGGACGTGTGGTTAGTCCGCCGAGTCGA
TGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCTTCCAAACGCAGATTCTCTTGGATTTGTTGACACCGGTTCGTGATCCTGACTTCCTCCTATTGCT
CTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGGCTACGAGTGACTGCCGTGACAATCGGTGTTTCCGCTGGGTTGTCTATGG
CGTACAGTTTTTCGGCTACTCGGTTAATCATTCTCAGCTCTACTTTCCTATCCGTCCCGAGAATTACTCGTCCAGCTTTAGCTTCCAGTGCTTCTGTAGC
GAGGGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTTGTTTCGTGAGATCCTTGTGTCGAGCTAGCTCCACTTGC
AACGTTTCTTTCTTGCATGCTATCACCCCCATGGATTGCTGGATTGCAAGCCGGGAGTCACAAACGATAATCAGATCGGTTATCCCTCGGTCAATCGCCG
CCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGATGTTGACTGTGGTGGACGACAGGTACGCACTCGCAGCAATCTCAATGTCCCAATTCGGAAGGCA
CCACAGTATCCACGAACAACTGCCATACCCGCCGTATTTAGCCGTCTTCGCTGAGCCATCAAATGACAGCACGCATCCTGCAAAGTCAGCTGGTATTCGG
GCATATAGCAGCGCTGGGTCCATTCGAACTGTCGCCGAGTTCTTGGAGGGAGGCGCCAGGTGCTTCAAGGAATCGTCGAGTCCGATAAACGGGGTTATCG
ACGCCTGGAGCAACTGGGCGAAGTCTACATCTCGCTCACGTACTCGCTTCACCACCTTCAAATCGTAGGGCGACAACATAACTGCGAAACTGACTGCGCG
GCCGTACAGCGACTTAGACTTAAACACCCACTCCAACGTGGAGAAACGGGTGTAGACGTGTAGCGTCTTTCCCGCCAAGAGAGTGTAGCACACTTTCAGC
AATTGTAACAGCGCGACTACTTATTTCTCAGCGGGATGATAGCCGAGTTCATTCTCCTTTAGTACGCGTCCGCAGAAGCGAACTGGGTGCAGCTTGTCGT
CGTGCGGTTGCATCAATGTACTGCTTAGTTCCCACTCATTGGCGTACAACATTATGTGTACTTCTTTCGCCGAGTCGAAATGACGCAGAATTGGAGCTTC
TGCTACCCGTCTTGTGAGCTCGGCGAATGATGCTTTTGCTGACGCTAGGTCACCCCCAGGGCCAAAGTCCGTATCCTTTAGCTGATAGAGTACTGCTCCG
TAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCATCCCCTTCTTCGATTTCGGGAAGGCGAGCTCGGCGATCG
CGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGTTGGATAAAGATACTCTTGGTAAAGCTGAT
GCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAACGTCTCCCCTCCAAAACAGATATCATCGACAAACGAC
CTCCGCTTGAACACCGGAATCAAGGAAGACTGGTCTGGTTCTCCATTAGCAAACATGTCGCCGTCCGGTCCGTTGACCAGGTCTTGGACCGGATCGCAGT
CAGCTTGTGATTGGCGGTCAGCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGACTCCGCCGAGCTCAACTCGCCGAGTTCCCGACTCGGCTTC
AGCAACAGCCATTCGTTCGGCAAACAGCTGCCATCCTCCCTTTGGTTGAACATATCCCCATAGAGCGTTGTCGATCAGTCGCTGGTAAATCATAGGCGCA
TTCTTCAATCCAAATGGCATTCGTAACCATTCAAAGTGTCCAAATGCACAGACGAACGCTGAGATCTGCCGAGCTCGGCGTGTCATCAAGACTGCCCAGA
ATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAACTTTCCAATTCGGTAAGCAGGTCATCAACCAGCGGCATAGCGTATTCCATCGGCGTCGTAAC
CGCATTAACCAGTTTATAGTCAATGCATAGCCGAATATCCACACCATTTTTCTTGAGCACTATCACCACTGGCGAAGCCCAAGGGCTGCTCGAGAACGAT
ATCAACCCCGCTCGAAGTAGCCCTTTCAACAACTCGTAAAGCTTGCTCAAGTGGCGGAGAGGTATCCGCCGAGCTCTCTGCTTGATGGGTGAGTGCCCTT
GAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATTACC