Description :
From Genome Similarity Track
Location :
Scaffold_170:212- 1884
Sequence
1672 bases(100 bases per row)
TTCCTTCAGCTTCGTCTCAAGCGCCGTCACCATCTGCTTCAACAGCGAGGTTTCGTCCAGATATTGCTGGTGAAGGATACGGACGTCTTACTGTAGCGCT
CCCAAAGACGATGCGTTCGCGTGAACCATCTGAACCATCGCATCAGGTGCAGCCACCGATACTGAAGCGTGGCAGGGCGCCATCGATTCCGCTGATTGAT
CAACAGGGACAGCGCCACTACCACGTTGAGCGCCTGCTGCGCGTGCAGCGGTGTAAGGGGAACACTCACTACCTTGTGAAGTGGTGCGGGTACGATTTGT
CGCAGAGCTCATGGGAGCCTGCTGAACGCCTCCTCGAGGACATTCCCGATTTGGTCGCCGCTTTTGAGCGTGCGTTGATGGCGAGCGAGACTCGTCCATC
TGCCGCTTGTTAACACCGCAACTCGTACGAGCACGGTCAACAGACATGGTCGCTTCGCGGTACTTTTGTACACGCTGCACAGCGAATTGCATGCGCTGAC
TGCGTTGAGCCCCGGGATCGGTGGCCAATATGCGCACAGCGCCAAAACGTTTCACACCGGTTCTTGATGCCAAGAACGCGGTTTCATATTGATCCTCGGT
CTCACCCTCGTAAAGGATAACCGGCATCGGGTGCACGCGCAGCGCCCCATCGCGTCCTCGCAGATCGGCTTCGCGCCATCGTGCGAGCTCGGAGTCGTAC
CTCTCAAGTGTAATCCGCGCCCGTGCAAGTAAATTTGCCGGGGTTTTCGCTGTCGGCCATTCCTTTGGCGGCGGCATAATGGGAAGCGAATAATGAACGG
AACCTTTTGGCGGTGGTTCCAGTCCGGTCTCATTATTGGTAATGATGACCTCCTCCTTCTCCCTTTCATTGACTGTAATAGGCTATATCTAGCCATTACA
TGAAGGTGCGGCTGTGCCCTACTTTAATGTTGGACACACCACCTTCGAATCGTACTTTGTGGACAAAGACCTGTGCCTTTGCTTGCGCAATGCGCACCCA
CATGTACGAATGTCGTCATCTGATGATGTCACAAGTATCCATGTACGAATCAAGTACAGAGTGATGGTTCCGACTTGGGAAACTGTCTGGATGACGAGAC
CGACGTGTCTCTATCATCTGAAGTGAGTGGCGGGAGTCGGTAACTTTGCAAGGAATCTCCGCGGTACTCCAAGTTCAAGTTTCCAGCAGATCTCCTAGGT
TCAACCTCAGTGTACCCAAGGTTTTATATATCAGGTTCATAGGTTTTATTTCTGCATGTGTAGGTTTTAGTTGTAAAACCTCTAGGAGCCCTAGTGGTGT
TTTATATGTAGTGTCAGGAACCATAAGCTCATTTTCAATTCAGTTGCAATTTTTCCAAGTTCCTCCCAAGTCTTCCTCTCAAGCGCAAGCGTGCGTGCTG
TGTTTGAGGCTGTCTCGGATAGCCTCTTACACCTGGTAGCACTTCGTAGTCCTTTCAACGACCACGTCAAGAGTCTGCATAGGCCGCTTGTGTAGCGTGC
GCAGACATTCCAAGACCCCTGTCCGATTGTGAGAAACAATGGAAGGGATTGAGACGCCGATGGGCTCGATGCCTGGAGAAACCGTGGAGCTGACGAATGA
GCATTTTCCTCATTTGTCGAGCCACGAGTGGGCAGCCCTCGAGCGTATGCGAGCGGTCATCGGTGAGGCGGC