Description :
From Genome Similarity Track
Location :
Scaffold_162:212- 1566
Transcript NameFunction/comments
Physo_144004OSJNBb0093G06.7

Sequence
1354 bases(100 bases per row)
GCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGACGTGGCATGTCGTGAACCGCGAGACGACGCCGAGCTTCACGGACTCGCGGGCCA
AGGACGACTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACTCGACGACTGCGAGGAAGCGTGGGTTGCGTGG
ACGCGCCTGAAGACGCTGTACGGTGGTTCGCAGAAGGCTGGACGCATCTACCTGAAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGCAACGTCT
TGCATCATTGCAACGAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCGCCAAGATGGAGGATGAGGACGTGGCGATCTGCCTGTTGCGCAGCCT
CCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCTGAACTACGATCGCAAGACGTCATGAAGGTGCTGACGAATGAGCACATCAAG
AGACAAGGCGAGAAGACGGCGACGGTGAAGACGGAGAATGCGGCCAAGGCGTTCAACACCGACCGAGAGTCTCGCCATTGTACGAACTGCGGGAAATTGG
GGCACACGATTGACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGACGCGGCGGCAATGGCAATGGCCGTGGACGCGGGGCCAGCAATGC
CCAGGGGAGGAACGACGACGCCAGCTACAACTACGACTACGGCTATGATCGAGTGGCGTTCGCGGTCTCACTGGAGTGTGGCATTTCGACGGGCAAGAAT
GTGTCCGGGTTGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAGGCCAAGTTCGCTCATTTGATTGAGCGGAATGAAGGCGAACTTT
CGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGGACCATCGTGGAACGAGTGGTTCTGCCCAACGGCGACGAGCGCGACATCGAGATCAAGAA
CGCGCTGTACGTCCCAAGCATGAGCAAGAATCTGCTTTCGGTGCCACAGATCAACAAGAGTGGTCTGTTCCGAGTCGTGTTCGACAGCACCAAGATGCAG
ATTGCGCACGAGGGCTCCAAGCAAGTGGTGGCGACGGCAAACCTCGTGGATGGACTCTACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTACTTCGGATGAAGACGTCGATGATGCTGTGCTGGACTTGGACGCGCTGGACCTGGACGACAACGATGGACCGCGCCAAACGAGCTT
CAAGCAGGCGGGGAAGCGCAAGTACCGACCGAGTGGCGACGACAACACTGCCAG