Description :
From Genome Similarity Track
Location :
contig_38:211995- 213625
Transcript NameFunction/comments
g8345.t1XP_009515530.1 hypothetical protein PHYSODRAFT_343769 [Phytophthora sojae

Sequence
1630 bases(100 bases per row)
GCCGTGGGGGACCTCATGGTGACGCTCCAGCGCTCGCTGCAGACCGAGAACCTCATCCGCACGGGCGAGCGCACGCCCGATCCCACAGTCATGGAGGACT
CGGCCGACGCCGAAGCACCCGAGGTGCCCAGTCATGCCGCCGACGAGATCCTGACGCTCGCGGGCATGCCCAGCGACTACACGGCGCGGCTCTTCTCGGG
GTACTTGCCGCTCCATAATGGAGGCCACGCCTTCTACTTCCTGGCCGAGTCACAGAGTGCCACGGCCCAGACGGACCCCGTGCTGCTGTGGCTCAATGGC
GGCCCCGGGTCCAGCTCCCTCTCGGGCTGTTTCTCGGAGAACGGCCCGCTCCTCGTGAACAAGGATGGCAAGACGCTGCGAGCCAACAGGTTTGCGTGGA
ACCAACGCGCCAATCTGCTGTGCATTGAGTCCCCCGTAGGCGTCGGTTTCAGCTACAACTCCAGCGGAGTCTACGAATCGGACGATCGCTCACAGGCGCA
AGATTTGTACGACGCGCTGCAGAAATTCTTTGAAAAGTTCCCATGGCTACGAAAAAACGACTTTGTGGTCTCCGGTGAGAGCTACGGAGGGATTTACGTA
CCTACCACGGCGCTGGCGATCCTGAAAGGCAACGCCGCAGTTACAGATCCAGCCAAACGTATCAACCTGAAGAAATTCGTCGTGGGCAATGGCGTGAACG
AGTACATGGGTCTCTCGACTGTCATGTTCGCGTACTACCATGGACTTTTGAGCACGGAAGCATACCAAAACTTCCGAACGAGCTGTCCCGTCCTGCACGA
GTTTGAAAAAAGTCCCCTGATGGCGCCGGGTCTGAGTGATGCTACCGGTAATCCAGAGTGCACGACCGCCACGATGGACATCTACACGACGTTGGTCTAC
GACCGCATCAACATGTATGACGTGTACGGCTCGTGCGCTGGTTCACCGAAAGAGGACGTCGAACGCCTCGTCAAGGAGATCTTGACGCCGTCCACACCTG
GTAAACTGCCACACCCGATTGGAAACACAATGGACTTGTGTCTGGACACGAGGCACCTTGAGTCATACTTTAACATGGCCGAGGTCCGCGACGCCATGCA
CGCAAACCCAGCGCTGGCACACTGGAGTGGCGACGCTCTGACTACGGCGACCATGGATACTCTCAGCTCGATTCTCGGTGCCGACCACTCCATGCTCCAG
CACCCGCAGATGTTGAAATACACACCTACACTAAACAGTGAGGTGACGCCGTTATGGCGTGAATTACTCGAGAGCGGAGTCAAAGGTGTGATATACCACG
GCGATGCAGACTTGGTCTGCAATGCTTTGGGTGGGCTGTGGGCAGTGGAGTCGCTGGGTCTTCCCCGCCTGGCGCCTCGCTCAGCTTGGACTTATGCGGA
GGGAAACTCCAAGCAAACGGGCGGCTTTGTGGAGACGTTCGAGGGGATCACGTACGTTACTGTAAAGGGAGCGGGGCACCTCGTGCCGATGACGGAGCCT
GAGGAGGCCAAGCAAATGCTGGATCTGTTTGTGCTTAACGGCTTAAAGTAGTGGATCTGCGTTAATCATGTTCAAAAATTTAGTCGATCGATGAGTGAAT
ACAATACACTACAGCTTCGAGTGCCTGCGC