Description :
From Genome Similarity Track
Location :
Scaffold_213:21199- 22388
Transcript NameFunction/comments
Phyci_250718Hypothetical protein
Phyci_137732Hypothetical protein

Sequence
1189 bases(100 bases per row)
agtgcaagttgtttgcacgccgcgtcaagtggtgtggtaagctaatcgatggcgaaggggtggctcatgacccggagcgactcgaagctctccgaatgat
gccgctgccgcccaccggcaccgctttgcagcatttcttgtgagctttgaactggctgcgcgacagcatggtggattatgctaggactgtggcaccctga
caggagAAGCTCGAGCAAGTGATGAGAGAGCGCGGCCGCCGCAAGTCCCAGCTTAGCGGTGCTACACTGAACTGGACCGAAGATGAGGTAGTTGCATTTA
GGAGCACGCTGGCGATGGTTGAGCGGTCTTGCAAGCTCATTTTCCCTGAACGTGGGGCAACCGTGTGCATGTTCAGCGGTGCCTCGCTGTCCGGCTACGC
CATGGTGGTCACGCAGGTCCGCCATTGGCAGGATAGCGTTCCTGTAGAGGAGCAGTCGCATGAGCTTTTGATCTACCGTGGCGGTATGTTCAAGGGCGCG
CAACTGAATTGGTCTATCGTGGAGAAGGAAGGGTACCCCATTGTGAAGGCGTGTGATGAATTGGACTACATGCTCGCTCGGGAGGAAGGGTTTCACATCT
ACTGTGATCATTCTAACCTGATTCAATTGTTCTCGCCTGACAAGGAAGTGAAGCAACATGTCAAGGGCAAGCTCCAACGCTGGGTGCTGAAGCTGATCGG
CTGCAGATACGTGATCCACCACATTGCCGGCGAGGTTAACCTATGGGCCGACATTATCTCTCGTTGGGGACAACCGGTCGCTGCTGGTGCTGATGGCGCT
CTCGCGGTGAAGCGGATGACCACGCGGTCTGCCCAAACGCTCTCGGAGCTGCGTCCATTGCAGGACGGGCAATTTGTCTGGCCCACACGAGATGATGTAG
TGAAGGCGCAGTTGCAGCACCGCCGCGACGCACCAGATGAAGGGAAGAAGGAGGTTGATGGAGTGGTTGAAGTTGAAGGGCGACTCTGGATCCCCACCAA
AACCAAGAGTTTGGTGCGGCGCATCTTCGTGATCGCGCATTGCGGTGCACAGGGACACCGCGGTGTCCATGTGATGGTCGAACTTCTCAACCGCCATTTC
TCGCTGGATAATGTCCGACCAGCAGTCGTTCGTtttatcaacgagtgtcttctctgcaagcatgtcaagggtggcacactgatccagcg