Description :
From Genome Similarity Track
Location :
contig_59:211952- 215939
Transcript NameFunction/comments
g11086.t1hypothetical protein

Sequence
3987 bases(100 bases per row)
TTTGATGCCACAGGGTGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGGGTTTCGTCAAGCGTTCTGGGAATCTACCCACAAGCTACCGA
TCATCAAGATCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGGCTCGGGTGCAAGCAGCGTCGATCTCGAGCTGGTCCTCGGTGGCAGACCGTCCT
CAAGCATTTACTGGCGGGGATGATCGCTGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCTTCCTTCACTTTCCGCGCCAAAACGAAAGGTGCTTT
TGGTACCCCGGCCTTGGAGCCACGCGGGCGCCCCCTGACTTGATCAACGCTCTTCCTACCGCAGATTCTGCCGACCCGTGGCGCAACCAATATTGCACAC
AACTGGGCGATCATCCCGGGTCCCGCATCGCACGTCTGGACGGTAAGTTTCGGTCCGTCGTCGACTCTGAGTGAAATAACCCTCTCCAAGGTCTTGATAA
GCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACCCGACCCCGATCGGCATCTTCCTTCCCCGATCGCAAACTCACAATTTCACA
AATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTTCCCCTTCA
TGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTTCGTTCAAAATCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGACCCAAGTTGGA
TCGTCGTAACCCTTCCAGAACACCAGAAAATCTGGGTGGACTCGTCCATAGCGCGTCCGGCGGCCGGTTCGTACATCCGCAATCTTCTCCACTTCAAACT
CGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCTTCCGGCAGGAGGGCTTCATCGAAGTCCAGGCGGTCGCTCTTGGCCACAAGCAACGACGCGTCAGGACG
ATCGGGAAACCTCCGGACCAACTTCAATTTGGACACATGCACGATCGGGAAGATCCTATACTCTGAGCCCGCAATCTCAAGACGTGCGGCGTGATCGCCG
ATCATCTCAGCGACACGAAAAGGTCCATGCCACAGGTGCGCAAGCATTCGTGCATACCCCTCCTTAACTCGATCGAGGTGTAGCCACACTTGAGCGCCTG
CCTCGATGTTGTGGGGTCGCAGATCTTCGTTGTGCCGGTTGGCTCTGCCTCTGATCGCCTCGCGCAGTCGCTCGCGAACCTGTTCCCGCGCTCGCTGGTA
GTGTTCTTGTACGTGGTACCTCCATCGACGGGGCTCCTGATCGCGTCGGCGCGTGCTGCCTAACGGTATCGCCGCCTCCAGCGTCGATCGCGGGTCCCAC
CCGTGGGCCAGGTAGAATGGCGTGTCGCCACGAACTCGATCTTGGGCCGTATTCAGAGCGAACGCGATTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGT
TCACGTCTGACACGTACATCTTCAGCGATCGCGTTAGAGTCTGCACCATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCGGTACGCCATCGTAGCTCTCTG
TTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGGTCATGGCGGATGACCTCACTGGCGCCGAAGCGTCGAAAG
ACGCATTCCTCGTAGTTCTCGGCGATCGTCTGGGCAGTGCGAGAGGCGCTTGCTTTCGCGATCACGTATCCGGTGAAAAGGTCGACCCAGATTAACAACT
CTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGTCCATGGCGATCATTTGGAATGGGTACGTAGCTTGTACATTCCCAGGCGATTCTCCCTG
AATGAGGGGGCGCCCTTTCCCCGTTTCACAATCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCTTGACA
CGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGGTAATGATGCAGAACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGCG
CGAGGGAGTCTCGGTCTTCGTCCGATTGCGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGA
CTTAGCATCGCTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCA
CTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTTCCGGCGTTCGTCTCGACCGTCGTGCCGATCGCGTCACGAGTTACAGCGTTATTATCCTTCGGC
TTCAGGAGCTCGTCCAGCCGATTGTGATCAGGTCCTGCCGATCAACTTCCAAGGTAACTACGGTTCCTTCGCCCCGTTGAAGAGCTTCGCTAGCTAACTT
GTCCGCGCTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCA
GGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCTCCGCAGATCACGACCCGCCCCCTGTCCATAGTGGACAGGAGATCGA
AGCACAACAACAGTCCGCGATATTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCTTCCACAC
GATCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGTTTCATCCGCTTCGACCGTAGGGGGTGGCATG
GTGATCGTCAGCCGGGGCTGCTTCACTGGGGCAATCGCGATCAACGCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCAGAATTT
CATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAG
CCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGACTTCCTTGTC
GACAATCCCGTAGTTAATCTCGTTGGGTTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATC
GCCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATG
CGATTTCGCTCGGGCCCAACGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCGGGGATGGACCTGTTCCTGAACCTATCTCGT
GGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCATAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCAT
CGATCGCAGTGTCTGCGGGAAGGGAAGGTTGCCTAACATCTCAAGATCTTTCGAGTGGGCTTCAAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCC
ACTTTTCGTCGGCCCCAGAAACTTCTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTTCAACCTTCTCACACAGCATGTCCC
AAGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTCCCCAACACTGACGGTCTCGGCTCTGGTTCTGGCTCGCCTGAATCGAACACGTCGAT
CGGTTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTATCAATCAATCGCTGGTAGATCTGTGGCGCATT