Description :
From Genome Similarity Track
Location :
contig_59:211948- 215942
Transcript NameFunction/comments
g10620.t1hypothetical protein

Sequence
3994 bases(100 bases per row)
TTTGATGCCACAGGGTGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGAGTTTCGTCAAGCGTTCTGGGAATCTACCCACAAGCTACCGA
TCACTAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTACGTTTTGGCTCGGGTGCAAGCAGCGTCGATCTCGAGCTGGTCCTCGGTGGCAGACCGTCCT
CAAGAATTTACTGGCGGGGATGATCGCTGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCTTCCTTCATTTTCCGCGCCAAAACGAAAGGTGTTTT
TGGTACCCTGGCCTTGGAGCCACGCGGGCGCCCCCTGACTTGATCAACGCTCTTCCTACCGCAGATTCTGCCGACCCGTGGCGCAACCAATATTGCACAC
AACTGGGCGATCATCCCGGGTCCCGCATCGCACGTCTGGACGGTAAGTTTCGGTCCGTCGTCGACTCTGAGTGAAATAACCCTCTCCAAGGTCTTGATAA
GCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATCGGGTCACCCGACCCCGATCGGCCTCTTCCTTCCCCGATCGCAAACTCACAATTTCACA
AATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTTCCCCTTCA
TGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCATGTTCGTTCAAAATCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGACCCAAGTTGG
ATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGGTGGACTCGTCCATAGCGCGTCCGGCGGCCGGTTCTTACATCCGCGATCTTCTCCACTTCAAAC
TCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCTTCCGGCAGGAGGGCTTCATCGAAGTCCAGGCGATCGCTCTCGGCCACAAGCAACGACGCGTCAGGAC
GATCGGGAAACCTCCGGACCAACTTCAATTTGGACACATGCACGATCGGGAAGATCCTATACTCCGAGCCCGCGATCTCAAGACGTGCGGCGTGATCGCC
GATCATCTCAGCGACACGAAAAGGTCCATGCCACAGGTGTGCAAGCTTTCGTGCATACCCCTCCTTAACTCGGTCGAGGTGCAGCCATACCTGAGCGCCT
ACCGCGATGTTGTGGGGCCGCAGATCTTCGTTGTGTCGGTTGGCTCTGCCTCTGATCGCCTCGCGCAGTCGCTCGCGAACCTGTTCCCGCGCTCGCTGGT
AGTGTTCCTGTACGTGGTACCTCCATCGACGGGGCTCCTGATCGCGTCGGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCGCGGGTCCCA
CCCATGGGCCAGGTAGAATGGCGTGTCGCCACGAACTCGATCCTGGGCCGTATTTAGAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGG
CTCACGTCTGACACGTACATCTTCAGCGATCGCGTTAGCGTCTGCACCATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCGGTACGCCATCGTAGCTCTCT
GTTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTGGCACCGAAACGTCGAAA
GACGCATTCCTCGTAGTTCTCGGCGATCGTTTGGGCAGTGCGAGAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAATGGTCGACCCAAATTAACAGC
TCTGTGTTCCCTTTGTACGACTTTGGTAGAGACGGAATGTGGTCCATGGCGATCATTTGGAATGGGTACGTAGCTTGTACGTTCCCAGGCGACTCTCCCT
GAATGAGGGGGCGCCCTTTCCCAGTTTCACAATCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCCCGCTCCAGTGGAAGTGCGCCTTGAC
ACGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGGTAATGATGCAGAACGTCTTGTTGTAGCGTCTCCGGGAAGACCAGCCGC
GCGAGGGAGTCTCGGTCTTCGTCCAATCGCGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGG
GCTTAGCGTCGCTCGGCGACAGGTCGGTCACTTTGCCCCGCAGGTACGATTTCATGTTCGCAATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTC
ACTTCTGATGCGTTGCACGATCGCTTCTTGCAGGACTTCCGGCGTTCGTCTCGACCGTCGTGCCGATCGCGTCACGAGTTTACAGCGTTATTATCCTTCG
GCTTCAGGAGCTCGTCCAGCCGATTGTGATCAGGTCCTGCCGATCAACTTCCGAGGTTACTACGGTTCCTTCGCCCTGTTGAAGAGCTTCGCTAGCTAAC
TTGTCCGCGCTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGTC
CAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATCGCTAAATTGGAGTCGCCGCAGATCACGATCCGCCCCCTGTCCATAGTGGACAGGAGATC
GAAGCACAACAACAGTCCGCGGTATTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATTCCGGCAGCTTCTAC
ACAATCGCACTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAAATCGCGACCAGCAAGGTTTCATCCGCTTCGTCCGTAGGGGGTGGCA
TGGTGATCGTCTGCCGGGGATGCTTCACTGGGGCAATCGCGATCAACGCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCAGAAT
TTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACC
AGCCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGATCTCGTCGTCAATATAGTGTAATTCACGTCCAGCATCCGCAGGAGTGCCAAGACTTCCT
TGTCCACAATCCCGTAGTTAATCTCGTTGGGTTTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGG
AGATCGCCCACTGGCTCGCGTAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGT
GAATGCGATCTTCGCTCGGGCCCAGCGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCTGGGGATGGACCTGTCCTGTTAACCT
ATCTTGTGGAAGTCCGCTTCGCGCAGCTCGTATAAGACAGCGGCATAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGG
ACTGCATCGACCGCAGTATCTGCGGGAAGGGAAGGTTGCCTAACATCTCAAGATCTTTCGAGTGGGCTTCAAAACCGTCGACGGACACTCGGTGTCCCAA
GTAGTCCACTTTTCGTCGGCCCCAGAAACTTCTGACCACACTGATGGACAAATTCCACCGCTCGCAGGCGTCGAGCAATGCCTCTACCTTCTCACACAGC
CTGTCCCAAGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTCCCCAACACTGACGGTCTCGGCTCTGGTTCTGGCTCGCCTGAATCGAACA
CGTCGATCGGTTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTATCAATCAATCGCTGGTAGATCTGTGGCGCATT