Description :
From Genome Similarity Track
Location :
Scaffold_237:21194- 24212
Transcript NameFunction/comments
Hyaar_Emoy2813037Amino Acid/Auxin Permease (AAAP) Family
Hyaar_Emoy2813038predicted protein

Sequence
3018 bases(100 bases per row)
TGGGTTCCTGCCTTCTCATGCCCTGTGTCTTCCTTGTGCTGGGTGGGGGTCTGCTCGATCGGCTCTTCCCGGATGCCTGGAGCACCACCGTCTGGATCAT
TTTAATGACTATCACCGTGCTCCCCCTTGCTCTAGTACCTACCCTAAAAGAAGGAGCTGGAGCTGCTTTTGCTGGTTGCATGGGAACCCTCATCGCTGAT
GGCCTGGGGATCGCTATTGTAGCTCACGGAATGCGTGGTGACCACCCGTCCGTGCCGTCGCCGGAATTGAGTTTACCTCAAGTTGCGGGCGCCTTTGGGA
GTCTCGCCATGGGCTTTGGAGCTGGCATTGTCTTGTCCGATGTCCAGCGGCAACACAGTGACCCAAGTCGCGTCCCCCGGGTCGTCATTGCAACCATGAT
CTTTGTCATGATCATCCTGCTGGTCTTAGGGTTCGTCCCGTACTTCTCAGTCGGTTGTCAGATCTCGGGCAACTTGCTGTACATGATCTACCCCGATGCA
ACCACGGGGTTGACTCTACTAGGCTTTGTTCCAAAGTGGGGCACTGTCGTGCTCGCCTACATTGCCATGCAAATGCACGTTACTATAGCTTTCTCCGTGC
TGATTAACCCCGCTTTCTACATTGCGGAGCGATTGGTACTCGGGATGCACGGGAAGAAACCGGTGGAGATGGAAACCGGATTGGCGTTTCAGGAATCCGG
GACCCCTATGCCGAAAACCAGTGAAGTGTCGGCGGTAAGTGTGACATCCAGTCGTCGAATGCGGACGTCCGTCTTCCCTCTTACAGGCGAGATCAACAAT
GACCATGAACTCGAAGCGGCCGAGTACCGAGGGGCGAATGCGATCAAGTACATTCTACTACGACTCGCGATCATCGTCGTGCTCGTGATCCTTTCGATCG
TTTTTGCGGATCATTTCTCGGACTTCGTGGATTTCGTTGGGGCGTCGGCGATCACGGCCAATTGTATCGTCCTACCCACGGTTTTCTACCTCATGAAAAC
GTGGGAACACGTCCCGCTCTATGAAAGGTTTGGCGCCGGGGTGATTATTGTCGTCTGCACGATTCTCGGCTGCTACTCGACGTACACTGCGGGCAAGAAT
TTATTTTCGCCTTCGGACTCGGAAGCGCTATTCCCGTACTGCGACGCCGAGTTCCAAGATGTGGTGTACTACAATCAAATGGCGCTGTAGCTTGAAGGCA
AATGGTAGGTAGGTGTTGGGACTTATGCGATGAAGGAAGGACACGACGTACATGCTTGTGAACAATAAAAAATAAAATGTGTTGGCCCATGTCGAGCGGA
GTTTGTATGTGTATGTAGGTATTGTTATTTTATTATTTAACATTATTAACACTTAGAACTGTCGTGTGTGGTGAGCAAGTTAATGGGTATGAGGGAAGAA
GGTGGTGGTGAGGTGTATATGCATGTATACACTTGTTACTAGCAGATTTGAGGGTCACTAGGGAAGTTGGATTATATTACTTTAGAGGACCTCAGGAGTC
GACCGTGGTGATGGATATTGCGTGTGATGCCCGTGAAGTATTAGTGTTAAGGCTGTATCGGAAGATGTTGGATAATGTCCATGTTTAGTAGATGTTTTAG
CTACCGTTTGTAGAAGAGCTGTTGACGATATTTTATCACGATTTGTGGAACGCACGTGCACACGCAGGTAGACGTGATAAAGTGGCATTTAAACGGACGA
GAAGCAGCTAGATAATTGCGAAAAATCAATCTTTAGTCAGAGTAATTGCTGCTCCCGTAAGAAAAAAGATTCACAGATATCAGGTTGAGCAGCTGAGCCG
CTACATGTTCTGCACACCAGCTGTGCAGGTTCAACGATCATTAGGTTTACGAAACGTAGAGTGAGCGTCTCGGCTGTACATCTTTGTCACTTCGATGCAG
TGTTTGGTGTAGAATCGCCTCATTGTATGCAAGTTGACGCTGCAGAGATACTTGGTATGCAAACATATTAAAATGTCACGCGAAACAGCGTTTGTCGTGC
TCGGGACACCAAGTTTAGCTTCAATGGCATGGGACGAATGACAACACGGTAATATCTAGGTCATCCTGAACCAGGATAGTGATAAAACAATTCATGCACG
ATTACAGAGAAGATGGTGATTTTGATGTGTCGATCGGTTATCAAATGCACGACCGCAATGAATAATATTGGAGTATTAGTCGTACAGAAATCCAATTACG
GCTTTGTGATTTTGTCCTGAATAAGAATGATACAAATCGCATACCAGAATTAAATCGGAATGGTTGATCGACTATGGTAGATTAAATACGACGTACCACG
TAACGCATCGTGCGTCCAGAGGTGGGCATAGTGCATAAAAATGGAGGACCTGTACAGCTGTTCACCTTTTTTTTATATGGAGAAGAAAGACATTTGGTAG
TCACGTTCAGGTCAACGCCTAATAGTCAGTTGACTGCCAGAAGGCGGAGTTCGTAACACGACGCGATTAACCGGATGAACCCGTTTTTTATTAGTTTGCT
TCTTCCCTATTGCGAATCTTATACGAAGACGCATTAATTGCTCGTATCGACCACCACACAGGCCAAGCTTTGAATACTAACCTAAATTTGAACTCTCTTT
GCGAAGTCCACAGCAACGTCAACAATTCCAAAAACAGTTTAACACTAGAATAGAGTACCTCACGATGCTTTGAACGAACGACTCGTGTCCGTTCGTCCAG
CCCTAATCCCTCTCAATAAACAAGTCGCAATTCATCCAAGACATCCACATATCTATCCTACCTATACTATCGCCATCGGTTAGACCTAAACAAAACGCAC
AAAAGTCTTCCGCAATTACAATCACGATAGTCCACTTTTAGTACACTCTGCACCTCCTCCATGAACCATCGCTACTCGAGCCTCTCCCCTCCCGCGCCAC
ACAACATCAAAAGAAAAACACCGGTTCCCTAAATATACCGGTATCACCACCACCACCCCCTTCGGTCAATACCGACGTCTATCCGTCCGTCCGTTGTCAT
GAGCTACAATCGACGAGG