Description :
From Genome Similarity Track
Location :
Scaffold_34:211897- 214800
Transcript NameFunction/comments
Hyaar_Emoy2805021hypothetical protein

Sequence
2903 bases(100 bases per row)
CAGATTCCAGAGCTTCCAATTGTCGTCAATCCAATGAGAGTTCACTTCCGTGATAGAAAGATGATCAGGGGAGTCCACCAATTAAAAGTGGTGTTCAATT
TGGTGTTTAATTTAAGTATAGATATCTTCAGCCACTTAAGTACTGCAAATAGCGATGTTGGCAGATGTATTCGGCCGCAAGATTAGAGCGTACACGTATC
CTGTTAAAACGTCGCCACAACATCATGTCTGATTGTATCAGCGGATGTCAACAAGGAGCTCGTTGCAGGATGCAAAGCTCGAGAATGTCACTCAGTTGCC
TATATCACACAAACTGATGAGGCAAAGAATGCTCTGGAATAATTTTAAGCAACGCCTTCTCTAATGCCTGCCTATTTACTTGAGGTTTTCTGTTATATGA
TATCATGTTAATACAATATCAAACTCAATACATTAACTTATGCGAGACACACACTTTCGGATTGCCTAATTTTAAATAGGCACGCGTTGCACTTTGTTCA
TAAAGCTTATCATTTATCTGATGCTTGGTCATTAAATGCTTGGCCAAATTGTTCCTACCACTGATAGGTGTACATAAATACGTAGCTCCGCAAATTGATG
ATCCGCCTGACAAAAACTTCACCTTCTTCTCTGAACATTACAAAGTCCAAACTCAGCTTGTATTCTTGCTGCCATTGGTACTTGCAGCACCCCCTATTTG
ATGACTGACACTGTCGGTGAAGGTGACCGACGATGCCGTTTCTACTTACATCATTCATATTTTCTTTTCCATGGAATGATATTTCTAAATGGCTAAAACA
AATATATATAAGAATTCCTGACCAGTAAACATGAGAAACCGACACAAGTCTCCCCAAACAGTAAAAAGGATTCTAGAAGTGGGAAAAAAAGCATGATACA
GCACCCTATATTAGCAAGAGAAATATGCGTATTAGTTTGGTTACGATGGCAACATTATAATTTTTTTATAAGGGACCGATGGATTATTGGTCCGGTCAGA
CCCCGATCCGGGTCCCGGACCAGCCGTCTCAAACCCGGGTCTACCCAATGAAACTGCTACGGGTCGGAGCCCTTGTTACATGTGTGCCAGAGGACGGGAA
ATCGCGTCCGAGTCACACTCAATACAAGCATTCATAGCTATGTGAGGCAGACGTAAGACGCCCACCCAAACCTCGCTGCGCGTGAGAGAAGACGGTAATA
CCGCTTCCTCGCAGGTGCTAGAAGGTGTGTGTAGAGGTAGTGCGTGGAAGCTTTAAGCGACCGCCTATAAGTAGTAGCACTTGTAGTCCTTCCCACGACC
CGTTTCTCTATGAGCGTGTCAGTGAGGATGAGCCTCAATGTTAATTGGGCTCGATTTATCCATCTTTGCCAGAATCAAGAGGGAGGTGGTTGAGCATATG
GCTCAGATACTTGGTGACCAAGCCCTGACTATTTCTTAAGTTGCCCATCAGAGAAACATGTTCCTCAACTGGGACATCTGTGGAAAGATCGTACTCGGAC
GGCGGATGTCCGCGCTCCAAGGCACAAAGCCATGACGTGACAGAGTCCATCATTAAGACTCATAATTAGCTTCTGCTCGAGCAGGCTCGGAACGAGGTGC
TCATCATCACTGTTGAGACGCTCTAGGTATATTCAGACCGAGGCCTAGAAGGATGGACGCTCGGAAGTATAGTGTGTGGCAATGTTGCAGCTATGGACGA
GACCGAGGGCGAAGGTTGAGAGATGTGGGCCATAGACGTATCGAGGAAATGAGCAACTCGACGATGGCAGGTATCAAAGTGAACCGGATTGATTAGTTCA
GCACGTATGCGAGATAACCATGTATCAGTATGAAGAAAGACGAGTTGATTCAACTTAGAGCAGCTACAGCGACGTTAAACAGATTTTTGAGAGGCGTGTA
GAAGATTGCCACAGCAACATACACATAGGCACGTAATACATGTGTAGAACTTTCAGCACCGATAAAAACTCGACGCATGTATTCGTTTTCGGTTGGTGAC
TAATGATCGAAGCCAGGGATGAATGAAATCCGTTTATGTGGCGAGGCATTCGGGTTTATGGTTTAATACGATAAAACCCGATTTAACCAAAAAACCATGA
TTTTATTCGGCGCGATAAGTGGGCGCCTGCTGGGAAGATTCACTGCCGGAATCACCGCCACCGTCAAGCGTGTAGTCTTATCAAGTCGGCAAGTTGCTCT
CAATGAACTTCAGTTCGTCGACTCGATTGGGATTGAGGCAGTATCTCAGCTTTGAGTGAATGTCGCCGCAATTACGAACTCTGTCCACTGAATGTCGACG
GTCTGCGCTCATGTTTCATCGAATGAACTACGGGGCTTGTCGTCTACCACTCCAATAAATCACGAGAGTTGAGGTGTACCTTGGTACTTTCTCTCTTCTT
ATGGTGATTGACCAGAGTCTTTTAGTGCATGCATTCGGCACTCTTGGCATTTAGTGGAGACACATCATCAAGAAACCAGTTCCAAGCTGTGCTAGTTAAG
CGACCACGTTTTCATTCCGGAGCCCGGATCTCCATTTTAATATTATCATCAATGACCATTATGAAGTCCAACAGGGCGACGTGTGCGCCTCGCTGCTAAA
GGCTGAGAGAGTCGTCGTTGAAGTTATCGACATGATCGTCAAACTGGCTTGAAGAAAACGAAGATTGCGACATAGTAGTAAGTACGGCTAGAGGGTGCTA
ATCTTGCTAATATACTGACCAAAGATTATGTCTGTTGGTATCCTCGCAGTTGCAGGGATCGGTGGCCGGTCGGATCGTGCGTGAGTCACACGATTATCGG
GAAATAAATCCTTATAAATTGTGCTTTTGGACGATCGCAGGCTGTCGGGTTTTAATAATAACAATATCAAATCGCTTCTTGTAAAAACACTTGGTGTCAG
CCT