Description :
From Genome Similarity Track
Location :
contig_29:211872- 213692
Transcript NameFunction/comments
g5755.t1heat shock 70 kDa protein

Sequence
1820 bases(100 bases per row)
GTACATCTTCTGCAGGATCGGATTCGCCACGCCCTCCAGCTCCTTCTGCTTCGACTCGTACTCCTCCTTCCAGCGGACTGGTTGGCGTCGAGCCAGTTGA
TCGTCTCGTCACCTTGTCGTCCACCACCTTCTTGTCGGCCTCCGGGATCTGCTCCTTCAGCTTCTCGTCGTTCAGGCTGTTGCGCAGACTGTACGCGTAG
TTCTCGAGCGCGTTCTTGGCCTCGATGCGCACCTTGTTGGCCTCGTCCTCCGACTTGTACTTCTCGGCCTCCGCCACCATGCGGTCGATATCGGACTGCG
ACAGTCGGCCCTTGTCGTTCGTGATGGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGCCGACACGTTCAGGATCCCGTTCGCGTCGATGTCGAA
CGTCACATCAATCTGGGGAACACCACGAGGCATGGGCGGGATGGCGTCCAGGTTGAACTTGCCCAGAAGATGATTGTCACGGGTCATCGAGCGCTCGCCC
TCGAACACCTGGATGAGCACACCAGGTGGTTGTCCGCGTACGTCGAGAACGTCTGCGCCTTCTTGGTAGGCACCGTCGTGTTACGCGCGATCAGCGTCGT
CATGACACCGCCTGCCGTCTCCAGGCCCAGAGACAGCGGCGTCACGTCCAACAGAACAGGTCGCAGCTTGTCCGACGAGTCGTTGCCGCCCAGGATGGCC
GCCTGTACCGTGCGCCGTACGCTACGGCCTCGTCCGGGTTGATGGACTTGTTGGGCTCCTTGCCGTTGAAGACTCAGACAGCAGTTGCTGCACCTTCGGG
ATACGCGTCGAGCCGCCCACTAGCACCACCTCGTTCACCTGGCTCTTGGACAGCTTGCGTCGCGCACACCTTCTCCACGGCTCCATGGTCTTTCGGATAG
TCGCCGCACAGGTCCTCGAAACGGGCGCGCGTGATGGTCGAGTTGAAGTCCACGCCGTCACAGCGAGTCGATTTCAATGTAGGCCTGGGCGACGACGACA
GCGTCCGCTTGGCGCGCTCGCACGCCGTACGCAGACGCCGCAGCGCGCGTTGGTTCTGTGCCATGTCCTTGCGGTGTTTGCGCTTGAACTCCTGCACGAA
GAACTCGACGAGGCGGTTGTCGAAGTCCTCGCCGCCCAGGTGCGTGTCGCCAGCGGTGGCCTTCACCTCGAAGATGCCCTCCTCAATGGACAGCAGCGAC
ACATCGAAGGTGCCGCCGCCCAGGTCGAAGATCAGCACGTTGCGCTCGCCGCCCTTCTTGTCCAGGCCGTACGCAATAGCGGCGGCCGTGGGCTCGTTGA
TGATACGCAGCACGTTCAGCCCGGCGATGGCACCGGCGTCCTTGGTGGCCTGGCGCTGCGAGTCGTTGAAGTAGGCCGGTACCGTGATGACGGCGTTCTT
GACCTCCTTGCCGATGAAGGCCTCGGCCACCTCGCGCATCTTGATAAGCACCATGGACGAGATCTCCTCGGGTTGGAACGTCTTGGACTCGCCCTTGAAC
TGCACCGTGATCTGCGGCTTGTCGCCGGCGCCCGACGTCAGCTTGAACGGCCAGTGCTTGATGTCGGCCTGCACGATCGGGTCCGAGAACTTGCGGCCGA
TAAGGCGCTTGGCGTCGAACACCGTGTTGTGCGCGTTCATGGCCACCGGTTCTTGGCGGCATCACCGATCAGGCGCTCCGTGTCCGTGAAGGCCACGTAG
GACGGCGTGGTGCGGTTGCCCTGGTCGTTGGCGATGATCTCCACGCGGTCGTTCTGCACACGCCCACGCACGAGTAGGTCGTGCCGAGGTCGATGCCGAC
CGAGTATCCAGACGTCTTCG