Description :
From Genome Similarity Track
Location :
Scaffold_120:211821- 217216
Sequence
5395 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTATCTCGTGATTATGGACTTTA
GTTATTATGGGTTTATCTGAGTCTGTACCTCGCTATTTGAGACTCTAAAGCCTCCGCCGACCCCGTTCCACCCACCCAGAGGACACGAGAGGAAGCAGAC
GGGCGTGATGAAGCCATAGTGACGCTCGGTAGAGCCACTCATCAGTGAAGCAGGCCCGTAGGCGAAGATGACACCGGTTCGAGCGAGTCCCTGTTGAGAC
GGCCCGACTTCGCCGTCCGCTGTGCTTTTTCGAGAATGAAGGCTATGAAGAGGCGGCGGTTGCCAGAGGGAGGGTGAGTGTATCCGATTGGGGGATATTA
TTATCTTATTGCAATGGGTTGTTAGTAGTACTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGAATCCAACTTACCAACTGCGCCCAGACACC
GACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCAGTAGGGCGGGATCTTGCTCTCTCGGAAACTTCC
GAAGAGTTCAAGTCGTGAAGCTTAAGCGTCTTGGCGAGACGTGGAGCAGCAGTGGAAAATCTTTACTCTGCGTCCGTGGATGGTTCCAAATCCTAAGCGA
ATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTTTCCTTTGCGTTTCCTTTACGTCGTACTT
GCCGCCTCCTGTGACGGGATCTTGAGAGCTGAGACCTTCTAGGGTGTAACCGACCAAGTAGTTAATTCGGTTAACCTGTCGGATCTGCACGTGTAAAGGA
AAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCGCTACCAACACTAGATTCGCAATTCCTAACCTTCACGGAGCTCGTACGGCCAA
TGTAGTTCCGGTTCTTGAGGGCAGGAAGACACTTGCGTGTTACTGTGCAAATAGAAGACTGTATTGATACTTAGGCCTATACCTGCCTGGATTTCTACCT
TCTATGTCTTTTACTGGTTAAATCCCTTACCAGGCTCGGCTGCATGTCCTTTCTTTCCTTGACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGA
TCCATGGCGTAATCAATATGGTCACCCTATTATGGGTACACTCATCCAAATCCAGGTCGCTTGGATCCAATCCACTGTAAGGGTACATTCGTCATGGATC
TGAGCTCTCCAATCATCCAATATCATCTTGCAACCGTCTGTGACCTCCACTGTCCCACGAAAGTTCGAGATCCACTGCATCCATCATTCCTGGATCCTGG
ATCCCGGTCACTCTATGCGGGATCCTCCCTCTTCGAATCGGAACTAAGAAGTATGGGATCCGGGCCACCTCGCAGTGGATCTTGACTTCTCATTAGCCGT
GGTTGCTAGATCCACCTTCAGATGACACCCACCACCATTCCTTCATAGGATCCACACTCGATCCACCCGTACATTGCGTATCCCATAACCACCTAAGTGG
ATCCAGGTAAGAGTGGATCCGAGATAAGTCTCGGTGGATCTTGCTTTCCCGTACATCAGTCATACCAGATCCATCGTCGTGCATACGGGGTGCTGCTCGT
CATGGCTAATCCACCACAGGCAACTTGCATCCGCGCCGGACAATCCAAATCCTCTCTAATCACTTAGAATTGTCACTGATTCGGGATAGTGACCCCGCGT
TAGGTCCCTTCTCTTATTTCTGAGAAAGCACTTTATCACAATCGCCTCCTGTACGTTGTCGGCGCTGCACAACAGCGCTCACGGCGTGCACTACCAGCAA
ATCGCCGCGCAAGGCCCCATCCACCACTCCTCCGGTCAGCCCTTCTTCAATATCAACCACCGATCTGCGTACTCTAGCCCAGGCTCTTTCAGATCGGGTG
CAAACCTTGACGGCGGAGCTCCAGACGGCCCAAGATGCTAGCGACCAAGCTGCGTCTTTGCACGCCACCCAACTCCAAACCTTGCGAGCCCAGGTCCATG
ACCAGGCTATGGAGATCCAGGGGTGGGAGCACCGTGCGGCCTCTCGTTCGCAGGACCTACGACTCTTGTTGGCTGATCAGGCGGTCGAGATCCGCGACCT
GACCGGACGGCTGGATCGCGCCCCCCGTCAGCGAGATGTCATGCGAGATGACAACGACCATCTCCTTAGGGAGATGGCGCTCGCCGGATCTGAGATCATG
TGCCAGTGTCGATTCCTTCACCAATATTGATGTCTCCATTACAATTCATGTTGCTCGAAAACGAAAATACAGAGCTTTCTTCTTCTAGCCCAGTGTAGGC
TTTTGCTCTGATAGCTTCCTCCAGAATATCCAAGTCGTCCGTATTGTTCAATTCAGTCTTGCGGCAATACGTAACAAAACTTTGCGCCTTGCTGAGATGC
GGAATTTTTTCCGCAGAGGCACCAACAGCCAGCGCGTTTCAAATTCGAGCAGGTTTCAGACCGTTAACAGCTAGTTGGCGCGCCGTTCTCTTTTGTTCCA
ACGTCAGGCCGCCAGTAGGAGGATCATTTCCTTTCACTTCGTGTAAACCAAGCTCGTAAATATTCACTATGCCGCTTTTGCAGCATACAAGCGTCCTGCA
TTTCCAACGACACCTCAAAGGTGCGACACACGCATCCGCACACGTAGCTGAAGAACACGAGAAGACCCGGTATCGCATTGTGTGAGGTGATGGATCCGTA
CACACGGCACATATCGATGTGTTGCTGACAGTGACTTTGTGTTTCTTCGCGTGCTTCATGTTCTCCACAATACGCTCGCTTTCCACCTCCGACACCTGCC
GATACAGCATAGCCCACGGGAGTGGCTTTCCCATTTGTTAAAGCGGCTGTGTCAGATACATTGTTAGCAATCAAGCAAACAAAATACAATAATTACGTAG
TTTTAGCGTCCGTACGGTAGGGAGAGGATTTCGTCTAGCTACTCACTATGGGCTTACGAGTGCTGCGCGTAGAGACGGTGGCTGGTCTTGACGTTTCCTA
CCGCAGATTTTGATTGGATGCGTGTCGGCCAATCTCCGGAGGTTTGTAATTGGCCACTGGTTGGCTAAAATTTAGTTTGTTTGATTACCTGACATTTGGT
GGATTGATTGATCTTCTAGTGGATTTGTCAATTCAGCTATGGATTAGTATAGTGTGTTATTTACTGGGCTCACAGATCTGTGGATTAATACTATC