Description :
From Genome Similarity Track
Location :
scaffold_31:211737- 223746
Transcript NameFunction/comments
Plaha_PHALS_04079hypothetical protein
Plaha_PHALS_04080dynein heavy chain

Sequence
12009 bases(100 bases per row)
CATGAGCTACTGAAACAACATAATAAGAAATTTAAGACCAAGCATACGTACGAGCCACCACACCATTCCGTGCGAGATGTCAAACAGGTAAAAATGACTG
TTGATGTCTTTCGTGTGTATACAACCttaatttgatttttgttAGTGGGAACGAGAGACCAAACAAAGTTTTTACGCTATGTCAGCGGACGAGCGCGTGC
GTGCAAACCAAGAAATTGCAATTTGGAAGAAGCAAAGGgctgaaaaaaatcaataatAGTATACAGCTTCGCTCCTTTATCAGTGCAATTAGGTGTCCAA
CATGCAAAGCATTGCGCAGCCGCGACGGATCCAGTGATCAGGACTTTTGTCTGTCGGGACGTTGAGGGAAACAACGAAATTGGTGGAGTGGCCGGTAGTC
GATAATGTGCCGGCGCGAATCGAGGTTTTATAAAGAGGACATTCGTACACGTCTGTAGGCTGGTACTCTTCTCGTCGCATTGGCTTGAGCCAGATGACTG
GCATGCGATCAAACAGCTCATTGGGAACAGATTCCGCTATCGTTCCAGTGGTTCTGTCGTATCGCGCACCCTCCATGAAAAGTCCAAAAATGTACACGCC
AAAAGGCGGTGGAGCGCTATAATGTTCTCTGTCGTGAGCCATAATTTCGCACGAGACGACGAGGGCATCGATTGCGATCTGCCTATCGCGCGAGAATGAC
TGTTTAATGGCTGTCATGAAACCCTgagggaagaagaagccTGGCAACCAAAAAGCATTTGGTGGCCCATTTACCAGCCAGTTGTTTGTTAGATTAATTC
GCATGAAGAAATCTTCAATCCATGAGGCCAACGGTTTCAAGCACGGGTAGCCGGCGTTCTCCCATTCGCTGGGAATCTGCTGCAGTAAAAATCCGTTGTA
CATTTTTTCAAGTGGTCCTGACATGACTACAAGCCCTTTGATAGCGCGCTTCAGCATCTCAAGCGTGGAGTTTATGACCTGAGTCAGCACATTAAAGCGA
ATCATTTCTTGCGAGAGAAAGATCCCCAGTGAGTTGCGACTGCCATCAGCTGCCTCTGCGAACGTTACTGGGTGGGCCATGTTTTTCGAGAATGGCTCAG
GCATTCGCTCTTGTATCACTGTTACTATTTCTATTACAATACTGTCGTTGCTCTGTGATCCTCCGCTATCACCGCTATCACCACCACCACCCAACATCTT
TAGGATTGTGCCAAGCAGCAAACCTGTTTCCTTTTGCTGAAAAGTGATGTCGGCGTTAGCATGAAGACCAAAAATATCCGGCGCATCTGTAGTTGGTAGC
GAGCTAACATATTCTCGAACACTAGCTAGAGATCCTTCCGGTGGCGCGTAATAAAAATCAGAGGTCGTGAATCGGTATGAATTGTCCATAACGTCTTTGC
AAAAGAGTTTACGCATGATACTCGAGTTTGTGCGCTTATCCCATCGATCCGTAATTCGCCCGCCGTAAGAAATGTCCGCCACCATGACATTGAGCGTCGA
GTATGGAACCTCTTCCTGTTCCTCAAGATACAGCCTTACCTGTTGCATGCCCGTCTTCAAGTCACTATTCATCCACTCGTAAGGTATATTCCACCCGACC
GCGCCGAACTTGCGTCGCTCCAGACACACTGCATTGTAAAATGCAAGAGCAAACAACAGCTTTTTGTACTCACGTGGTTTTGTGCAAGCCTCGTAATCGG
CTTCTTTGATATCGCGAAACGTACGTCCCAAATTCGCTTTGATTCCTCTCGGTGGCTCGTTTGTAATTTTTATGCCATTTTGTAGAATAGGCACAGGAAA
TCGTGGACTTGGCATACTTGTGAGCCACAAGCGAAAGCTATCATGCATTTCATCCATCACCATTGAATCCAAGATCTGCTCGAGTCGACCAAGCCATGAG
GCAGCCAAATGACAATTTTGCAAACACACCCAATCACCGGCTTGCATGGCTTGTTTCATTAGCGCTTCAGCTATAGGCCCCTGACCTTGACCCATTGAGA
TAATTTTTAGACCAGACCCCTCCTTCCCTTCTTGTTTTGCGAGTTCGAGTAGGTAATCATTGATATCAGCGCCAGGCGACAGCACAAATATCAAAGGTGT
CTCCGGCCTCGAGTCTCGATAACAGCCAGCCAAGTCGAAGGGAGGAGACTCTGTGAAAATGTTTCCCAGCTCACGCCTGACGAACTCGCGAGTACCAAAG
ACTATTTTTTCTTCTCGAAAGACGCGCAGCACCAGCAACTTCTGAAAGTTCGCAAGACTGGATTCCCAAGGCTCCGGAAGAGCTTCAGCATGTGGATCGG
CTGACGACATGGCACGTCTCCACTCGGCCTCTTGTTGTTCTACCGATGTGGCCAGATCTGTAAACGCAGACGAGATATTTTTCATACCAACGACAGTCTT
CCATATACGGTCTGGCAGCCACGACGGACGTGAGAGCCCACATGATTCCATTTGTGCGCCTTGTAATGCGGAGCTTCTTTTGTCTCCGACAAGGTAAAAA
GACCATTCAGACGGTGAAATTGTACCGCGATGTAGGAGGATACTTGCTGCTATCATGAATGCGTAAGTTATTTTGTCCTTTTCAAATAGCCCACGACAAA
TATTGACAAACATAGTTGTTGTAATGTCCTGCATAAGGATTTCTAAGCGCTTTTCCAGAACTTCCGACCTCGCCGTGTTTTGCAACCGTgtgacaaagag
cttctgGTAGAAGTGCAACGAGTATTGGTACATGGGATCCACAAGTGCGAGGTTAGCAATTACAAAATATATGATGGAGCCACGCACTGCGACACATCGG
TATCCTTCGCGCGTCTGGTCGATCTCCAAGGACGTCGTTTCAGCCTCCGACATGCGTGTTTTAATCGCCGACGAGGTAACTTTGCTATGGGCTAGCGTGT
TTatcagctcttcatcatcgagAATATTTCCCTCAGAGTTCTCAAGCATGTGCAAGATCTTATCTTCGATCTCTTTAAGTTGCTTTTTGTCCGCAGCGAT
TTTCACAGTCAGCTCGTTCTTTTTAAGCTCAAGATCAGGTCGTTCGTTTCGAACGACATCAACAAGCAATTGGTCCTCGAGACCCGTTAGTGTGACAGTA
AAGTTAATGATGGTTACTTTGACACAAACTTCGGGCATGTAGTGAGGATTTGCCAATTTTGTGGTGATAAAGAAGCGGAAGTTGTCGCTGTACGGCACGT
CAGTATCaccaagatgaagaagattttgCCCACCCCGCTTAAACGTCTGCTTGAGTAACACAGGTTCAAGCGACGGATCGAGACCCTCTTCTACATTTTC
GAGCATCACAGGAGAGCCGTATCGAATGGCATTTTCTAATGTGCGCAGAAAATCTTTTTGCGTTAGCTTTATTATCTGCAACGATCCTGATGCTTTGTAC
ATGTTTTTGATCCATTTATTGCCTTGTCCCTGTGGATCGATCATGAGCGGCCAGCGCCGTCCCATCGTTGTAAACAAACCATTTTCGATTGAAAAAGTAT
CGGCAGGCAGCCCCATAATATTCCACTCGCGGACTACAACGGGATCTGCCTGGACCCGCTGAAAGGAAAAGTTTTCATCAACCGGTAAATGACTACTTTT
ACAAAATGAGACCCATTTGGCTTGAAGCTCATGACGGAATTCAGATGTGAATGGTCCGAGATACGCAATGCATCCGACAGATATAATTATGTCACCAACA
AGGTTAATCATATCACTGGCAAGATGTTCAGCGCAATCTTTCCAGCGACCTTGCTCTTCACCAAGCGAGTCAATCAAACGTTCAGCACGTAGAAGCTGCG
CCTGTGTTTTTTCCGACTGCATCTCCAAGTCTACTCGTTTTTGTTGCGTTATTTCCAAAATGTGCTTCAGATCCGCAACCTTTTTAAGTACTGCGTTCAG
CCCATTCTGTTTGACGTTGAGCTGCTTTTGTTCTACTTCAAGTCTCTGCTCGGCGATCTTAAGATTCTCCTTTTTTGGCTCAATATTCTTGGCGACTGTA
TCGTAAGTGTACATTGCGCGTACCCACATACAGAGAGATGTAGCTGCAGTCGAAATGCTGCTTAACGTCTCAGGCGTAAATTCTTCATCGGAAATGAATT
TTTGAAGCTGTCGAATAGTTTTGGAAGGTATATTATCCTTGTCAAACTCTTTTAGTCTCTCAAGGAATTTCATGTCATTCAGGAGCTTCTTGGCTTCATT
CCATTCTTGTTTGACTCCAAAAAGCAAGCACACAGCATTCATTGTCACGCCCACTAGTCTCGGAGGATTTGTAAAGGTCTTAAGCACCGTGATATCATCC
TTTTTCAGCTGTGATAAAGCCCGAATTGACGCATAATATGCCGGCATGGCTTCGTCCAAGTCTTTTTGACAGTCATCTTTGATCACTTTCACTTCGGCAG
CAATCTTATTCGCAGCTTCCACATCAGCTTGAATGAGCTGTTGCTGCTTGTCAGCTTCGGCCTGATCCTGAGCCACTTGGTTGAGTAGCAACAAAGTGTC
GTTTTGAGCTTGTGCGAGCACTGGCTGCAGTTCTGTCAGCGAGCTCTGCAAATTTCCAACCACCTCTTCTGTTTCTGTAAGCTTCTGTAGACCACCACGG
TAACGTGCCTCCTTTGCACGCACAAGTTGGCGATGCGTACGTAACATATCTACGTATAAACGGATGAGTTCCAAGTAGCTTGTCGGTGTTGTGTAGTTTT
GTCGTTTTAGCTGTTTGTAGAACTGAAGCGTGGCTTCCTCCACACTACGGTGGATCATCACAGCAGTTCGGCATAGTGTTTCAACGTGATGCTCAATTCC
AAGTTCATCAGCATTCGAAGAAAATACGCGATGGGCCACAGAATGAAGCGCGTCTTCGGGCCACGCATTAAACCAGTCGATCGTGCAGCAATTAACAAGC
GAAGGGAACATTCGACATCGATTGCGAAAGCCGGCACCGATGGGAGAAAAGGCTAGAACAACGTGCAAGTTATCCCGCACAAGCGTCACATAATACTGCA
AAACGTCTTCACGAGAAACCTTTCCGACTTGTTGGGCTAATGGGCGAACGAGGCCCACAATTTTTTCTATTTCATCATTCGCGTACAGGTTTGGTACCTC
CCCAGTATTGAGTATGTTATTAATGTCTTCAAGAAATGACTCATTAACTATTTGCGTATCAGAAAAGAGGAGGACGACTGGTGTGTTATATGCGCCTGCA
GTCATCAAAACGTTCTTGAGATCTCCGTGAAACTCATTCATACCATAGCCTCGAGTTATCTCAATTGAGAAGCATTTGTAGTCCGCAATGAACGATGCGA
GACGTGTTAAACTTTGGCGACCTGAGCCTCCAATACCAACAAGTAAAGCATTACCACGTGGTTGTCGTAACACACGACAAATCCGCAAAATGTGGTGTAT
AGCGTCATTAAAAAATACCAGGTGCATTTGACTCGGAAATGTGATGTTGTAATCATCCAAGTACTCTGAGAGCAGTGAGTTAAGCTGTCTCATATTTTCA
ATACGTCGATAGCTACGGATTTCACGCGCCATGAAGTCACCGTACAAGAGGTTTTCAAAGCGTGAAGGTGGCCATGTCACATTAAATTTCTTCGCCAAAA
GTTGTGAACAAGTCACATTAAACCAAGTACGATCATTTGTATCAACGAGACGATCGCGAAAGACACGAGTCTCCTCATGCAACCAAAGCGTTAGCAGATC
ATCTTCTGTCGGTACATTTTCTTGTTTCACCATTAATATACCTTGGAAGACCTTAGAAAGATCCCGAAGATTAAAAGTGTAGTGTGAtctcgacggtgtc
ggtaacATCTCAACCTCTACCTGTTGGTATAGCTCCACGGAGGCATCAACAATGGGGACGGCCAAATGAGTCATCACTGGTAGCTCGGCACCGAAAAAGC
CTCCTAATATAGATGAGAATATGCGTTGCATAACTTCAGTTGAAAGATTGGAAATCCAGACCATGTGAAAGTGGCGCAGCAAACGAGGGTTCACCTCGGT
GCGACCACCGCCAGGAGGTGCACATGCTGCTGCAAAGACCacattttcaacatttttgtAAAACAGTTTCGAGGTGTCGTAGTACCCGCCTTGATCAATG
ATTTGCCGCAGCAACTCATTTGGTGGCTGTGCTCCGTAAATTTCGAGTGCTGGCATGTTCAGGTCATCTACAAAAAAAAGCATGCGCTTTCCTTCTGGTG
TCCCAAGAACATTTTTACGCTTCTTGTCTAGCCGAAGCTCAAACACTTCGTTCAAGTTGCGAGGCTTTGTTTGAGCAGAATAGCTCATAGTTGACGTCAA
ACAGTTGTCAGTCTTGGCTTTCTCGTCCAAAAACGATTGTACAACAACCGACTTCCCTACTCCAGTCTCACCGCTATAAAGCACGTGATAATTTGCAAGC
ATGAGTTTCTCGAGAAGAAATCTGAAGCAAGTCGTGTCTTGTGTCGGAACGACCATAGTAAAGTACGAGGCATCAGGCACAAATGTAAATGCTGGTGTCT
TATCAGCCCAGGAAACCCATTTGCCGGTCGTATCATCAACAACCACTTCGTACACACTTCTAGTCTGTACTCCATCTTGACTACTGTCGATCAACGAGCC
AAATTGACGCATGCAAAAATCATTAAATTTGGGGCGCGAGGTATCGTCGATATTAGCGCCCACAGACCAAGTCACTGCAAATACAAAATACATGCGCACT
AGTACCGCCATATTGTTCGCGTTCGCATCGAATCGCGCACCTTTGTCCAAACAAGAGGCTAGAAGATTTAAGCAGCTCTGCATGAGATTGTGATCGTTGC
TGGGTATTTTTTCGTGGCAATTTTCACGCACAAATGCAATCGCAACCGGAACATTGGTCTCAATTAGTTCCAGCAATAGGTTGCACAGCTCCGGATGTTT
AGGCAGAAGAAGCTTCAGTGTCGTAGCTCGCCAAGTACGTGCTAATGATGTCATCCCAACGTGAACTTGCTCCATGTACACCATTCCACAGCGACTCACT
GTTGCCGGTGATGCCACGCGTAGATCTTGTACTTCAAACATCATATGCAGCGTTTGTGGCAGCTTGATTCGCTCGCTGTTTGAAAGACATAGCGTCTTGT
TGTCATCTAGCACCGTATTCATGTTCTCAATCCAGACAGCATCCACTGGGCCGTCAAAGATAACCCAGTTTCGACGATCCGACTCGGCTGCTTCCTGTAC
ACACTGTCGAACTAATTTCGGCACAAGACCGTCTGTCCACTCATTGGTGAGGTGATTGAACTCGCCATAAAGCTGCCCTGCTGTAATTGATTTCGGGTTC
AGTATAAGCCGCTGTACCTCTTTGTAATAACCATCGCGATCGACAACTCCATCCTGATACAGTTGAGTAAGTGCTCGCGCTAGGACATCGCAGTTGGTAC
TTTTTCCGCTTCCAGCTTCACCCACAAGCATCATACCATGCCGCACAAGTTGAGTTTCGTGTACCTGAATGGCTTTAGAGATGAACGAAGGCACTCGCTG
CAAGTGCAGCAGGTCCAGTTGCTGTTCAATGGATTCTTGAAGCAGTCCATAGTCAACGAACGGTACCACCACGCCTGGAAAGAGATCCGCAATGATACCA
CGAAAGAGCGGGAGATCCTGCTCAAGAAACTTCGGGACATTACTATCGCGCATTGCTCGAATAAGAAGTAATTCCTCCTGCATATCTGGTTCCTTGCGCT
TTAACTGACCAGCAGCAACAAGAACAGACTTAACTGCACGCATTCCAAAATCATAATGGTCTTGTTTCGATAACTGTTCACTAGAGAGCGAATAAAGTTG
CGTCATCTTGTGAGAAAGCGGCAATGCATTTGCAAATCCCTCAGAAAAAAGCACAATTTCGGCAATAAGCCGATAATCCGGCACCATCATCGCAACAGGG
CGAAAAAGCGCTTTCAAGTTGTCTGGTAGCTCTGTACGACCGGCGTACCCAGGGTTCATCGTGATGAAAACGCCAAATCCAGTATTCAGCTTAATaagac
ttccttcgaattcAAACTCGTTCAGATCAGCCACAATCGCCTGCTGAATGCAAAGTACTTGCTGTGCAATCACAGATAATACCTCAATATCAATTCGGTT
AAATTCGTCAAAGCAAGCCCATGCACCCGCTTGTGCAAGGCCAGAAAAAAAGCGCCCCATGATCTTGAAATCCAATCCATCCGAGCAATTAAATACGACG
CACTGAACTGCCAACGCTTTTGCCAGATCTTTGGTGGTTTCAGTCTTGCCGGTACCAGCTGGGCCAGCAGGAGCGCCACCAAGGCGTAGATGTAGCGCTC
CTGTCAGTGTCATGTAGCAAATGTCCGTCAACGGGGTGATTACGAGTCTCGGCGAATTCCCTAAATATTCGTAGCCATATATAAAGCGAGTGTTGGTTTG
ACGCGCAACGAAGTTCTTTACATCGTCTTCCCAGTAATATCGAAGCTGTCGAGTCCATTCAAAGTCACTGAGCGATGCCACTTTGCTCTCCGCTAATGAG
CGTACCACATCTCGGGCGTGCACATCAATAGTGATGACAGCACCCATTAAAATGCgttgaagcttcgtcaaggATCCACGAACAAGCTGTACCATCCCAT
CAATCTGCTTCAAGCTAAACTGAAGAAAGCTATCGACAGCATGGATATCAGTGCCGTTCTCTACTTGCACAATCGCCTCCGTAACATTACGTGTCCAAAA
GACCTGATCCACCAAGATGATCATCTGGGCCGCGTACCCAAATAGCCAATCTTGACGGTCGATGGCATCCTCGACAGGATAATTCATTAACGCTTTCACA
CCGTCCTCGTAAAGGCTTGTTCGCATTGCTTTCTCCACGTCGGAAAGCCACGATTCGACAGGACCCTTTGCTTTTACTGGCGTAGAAAACAGAACCAACT
CACCTTCGCCACTGACCATTGCTTGAACAAGATTACGAGCCGAACCAGATGTGTCATCAAACTGTACACTCTTCATAGCATCAAAACACTTGCCCAAATG
CGGCTGGACAGCACGTGGATCACGCGTCTGAGACAGAATTTCTAAAAGCTCGTCATTTGAAAGAAAGTAAAAGCGCGGGAATGTCATACGCTTGGTCTCT
AAGTAGTCTTCCAGCGACTTTTGAATCTCTTCCAGTACCTTGTTTGACGCACGAAACTGGTCTAAATACTCCGAACCAGCGTCGACCGATTTAATGACAT
TTGGACTGTGTTTGATTCGGAGCATTCTCGTTCTCCAATTCTTGTCAACAAGAGCGAACTTTTGTGCCTCGACAGGCAGCTGCTTTTGTATATCATCGGC
ACAAAATATCGTTTCCAGGTACATCCAGCTGCGCTGACATGCTATCCATTCATCTAATGTTTCTGACAGCAATGACAAGCGCTTGCTCCATCGTTCGACT
TCTTCTTTAACACCAAGAATATATCGCGATCCCATCATCGTCTGAAGACTGACCTGATCATCTTCAAGCAATGTCAACACGTCTTCTAGACTACCTAGAA
TGAACACATCACTTTGATCACGATGGTTCACGCACGTAAACTCCATTTGCTCCCAGCcatatttaattttttgcaGCGATGCCTCAATTTGAGCTTCTCC
CGAAGCTGTTGCTGATATCTCTCCAACCAACTCTTTCATGTCAAATATGTCGTAAGCCACAAGATTTTCTAATGTAAATGGAAGACCAGGATACCACGGT
TGCCGCAGTACCTTAAAAAGTTTTTCCCAGTGCCGATCTTTCATTGATAGATTACCCAAATCAAGTATAGTGGGCAATTTGAGCTTAAAGTTCGCTGTGC
GTTCTTTCAGCACCGCCGTAGCGTCATTGTTTAGTTTCTTATGTAGCTCATGGGCATTTTTATAGGCAACAGCGACGTCCTTCGATAAATTTTCGGCATT
AATCTCAACAAAGGATCGGGTCATAGCTTCTCGGTACAACTCTTTCCACTTCTCCACAGCCGTCCAGAGTGAATCCACATTCGTGAAGTACTCATGAGTC
GCCTGCAGGTTCGAGTACTCAAATGGAGTAAGATCGAACAATAATTGGTACTCCGTATATTGCTTCGATAGTTCATCCAGTTGAGCAAGACGCTGTCTCA
CGATTTCTAGCTCACTTTTTACAAAAGAAGGGTCCTCGACATGACTTGCATCGATATACAAACCTCCTTGCAACTGATGGTGCAGCTGAAGCACTTGTTC
GTTTACGCGATAGATGTTAGCATCTAATTGCTGAGTCATCTCGCCTATTCGACTGGCAACAAATGTGTCAACAGCTTCCGTCTCTTCCTTGTAATTTTCT
TGAATACTACGTAGGTCATCAAATTGAACCATGTCTTCCGATGAAATGCGTACGCCATAAGTATTTAAAAGTCGGTACATATCGTCCACAACAACAGTGG
ATTTGACAAGGGATTTGAGCTTGCTTTTTAGACTCTGCACACGCTCTACATACCCAGCGAATTCTTTAAGATGCTGCGGTCGCTGAAGCAGCAATTGAAT
GCGCTGCTTATATTCAGCAAGCTGAGATTTGCATCGTGCGCGTGCTAGGTCCTTGACCAAGCTCTTCATGGCGTCTAGCTTGGCGGTCGTCATGGGAATC
AGCGCCTGCTTAAGCTTGCGACTCTCCACATGTAAGATGCCAACTGTCTGCCCCGCTCGCATCTTCTCCAGCTCTTTTTCCCATGTACTAATCTGCTGCA
TGTCAGCTTTTAATGTGCTAACAGTGTGCGCTCTCTGTGAATATTCCTCGAGATCCCACCCTTGATCAAACTCGAAGATTGGCCTCACACTATCAAAACT
CTTAACGTATTCCGAAGCTTCAGCGTAGTCGTTTTCAACTTTATCAACCAATTCCTTTCGTATTTGTTTAAACGTTGCATTGCTTGTGATCATTGATCCT
AAGTGAAAAGCGTCAGCCAATACGTTGCCAACATACGGTGCAAATGGCCGAAGGTAAAGCACACGCGAAACTGAGCTAACTGTGCTTACAATATCGTCCG
TCATTGCAAGAACGAGGAGCTGAATCTGCTCGCTCGTCGGCGCAAATAGTGTCAACCGTTCTCTAAAGAATACTGTCGTTTCAAAAAGGCCAGTCTTGCG
AGGAACTTTATTCAATTCTTGCAAAAAGGTAGCACAGCTATGTACAGCAAGATTCACCAGACTTGCAATAGTGATACAATCGACAAGCCGAATAAAATTT
GTAATCATTCCAGCTTCCTCAACAGCTCGACGAGCGAGTTTACGTCTCTGCTGCTGTTCAGCTTTAGCAGCTACAATCGATTTGGTTTTGTCTTGATTTA
CTCCCATCCCTTTAAAAGAAAACTCAGACATAACATTATCTTCGGAAGGTGTCGGCTCGGTAAGTTTCTTAACGTCTGAGCATACGCGTTGAATGATTGA
CTGCAATTTTTCAATACACACTTCAAATTGCTTTAACCCTTCGGCACGAATCGTTCCTTGATACTCAACAAATGCTCCGCTTTCGTACGTTTTTTGAGCG
CGCACGTCGAGTAAAACAACACTCATTAACTCGGTATTCAATACTTTGTTCACTTGTAGCAAAGGGGAGCAAAAGCTTTCCCTTGCCAGAAACAATTTTG
CACTCAAACGCTTTCGTTGACGACAGAAAAGTTTGAATCGAATATTAGCACACCAAAGCAAGAATGTTTTGGTCACGAGATAGTGTTTAAAGAAGCGAAG
TGACGTCAATAGGTTGAAAAGGGTTGATTCACGCATCCATTCTGCCAGTGCAATGAATTCAGAGGGGCTACCAGCACAAATGTGTACAAGTCCACTTTTT
GACATAGTAAAGTGCTCGCTTGGCGCCACGTCGTCCTGTGCAACCACAACAAGATCGTACGGCCGAAATGTTCGCTTTGTCTGAACGCGATTCAAGTATA
CAAATTTTTGTTCATTGTGCGAGCCATTGCGCGCGAAAAATGTGATTGCATCTTCTCCGGTCTTAAGAATcgctgtcgtcaaagtagcAGTAGTCTCAGC
AGACGCATC