Description :
From Genome Similarity Track
Location :
contig_38:211692- 213322
Transcript NameFunction/comments
g7088.t1hypothetical protein PHYSODRAFT_343769

Sequence
1630 bases(100 bases per row)
AGCGCTCGGACCCGCTGAACGAGACGCTGCCGCTCACGCGCGGGCTGCGGTCGCGCCAGACGCTTCCGGCTGCGGGCCGCTCGCGCCGCCTGTTGTCCAG
CACTGGCCGCCGCTTCGTGCGCTACGGCGTGGCCTGCCTCCTGTTCCTGGCCGTGGGGACCTCATGGTGACGCTCCAGCGCTCGCTGCAGACCGAGAACC
TCATCCGCACGGGCGAGCGCACGCCCGATCCCACAGTCATGGAGGACTCGGCCGACGCCGAAGCACCCGAGGTGCCCAGTCATGCCGCCGACGAGATCCT
GACGCTCGCGGGCATGCCCAGCGACTACACGGCGCGGCTCTTCTCGGGGTACTTGCCGCTCCATAATGGAGGCCACGCCTTCTACTTCCTGGCCGAGTCA
CAGAGTGCCACGGCCCAGACGGACCCCGTGCTGCTGTGGCTCAATGGCGGCCCCGGGTCCAGCTCCCTCTCGGGCTGTTTCTCGGAGAACGGTCCGCTCC
TCGTGAACAAGGATGGCAAGACGCTGCGAGCCAACAGGTTTGCGTGGAACCAACGCGCCAATCTGCTGTGCATTGAGTCCCCCGTAGGCGTCGGTTTCAG
CTACAACTCCAGCGGAGTCTACGAATCGGACGATCGCTCACAGGCGCAAGATTTGTACGACGCGCTGCAGAAATTCTTTGAAAAGTTCCCATGGCTACGA
AAAAACGACTTTGTGGTCTCCGGTGAGAGCTACGGAGGGATTTACGTACCTACCACGGCGCTGGCGATCCTGAAAGGCAACGCCGCAGTTACAGATCCAG
CCAAACGTATCAACCTGAAGAAATTCGTCGTGGGCAATGGCGTGAACGAGTACATGGGTCTCTCGACTGTCATGTTCGCGTACTACCATGGACTTTTGAG
CACGGAAGCATACCAAAACTTCCGAACGAGCTGTCCTGTCCTGCACGAGTTTGAAAAAAGTCCCCTGATGGCGCCGGGTCTGAGTGATGCTACCGGTAAT
CCAGAGTGCACGACCGCCACGATGGACATCTACACGACGTTGGTCTACGACCGCATCAACATGTATGACGTGTACGGCTCGTGCGCTGGTTCACCGAAAG
AGGACGTCGAACGCCTCGTCAAGGAGATCTTGACGCCGTCCACACCTGGTAAACTGCCACACCCGATTGGAAACACAATGGACTTGTGTCTGGACACGAG
GCACCTTGAGTCATACTTTAACATGGCCGAGGTCCGCGACGCCATGCACGCAAACCCAGCGCTGGCACACTGGAGTGGCGACGCTCTGACTACGGCGACC
ATGGATACTCTCAGCTCGATTCTCGGTGCCGACCACTCCATGCTCCAGCACCCGCAGATGTTGAAATACACACCTACACTAAACAGTGAGGTGACGCCGT
TATGGCGTGAATTACTCGAGAGCGGAGTCAAAGGTGTGATATACCACGGCGATGCAGACTTGGTCTGCAATGCTTTGGGTGGGCTGTGGGCAGTGGAGTC
GCTGGGTCTTCCCCGCCTGGCGCCTCGCTCAGCTTGGACTTATGCGGAGGGAAACTCCAAGCAAACGGGCGGCTTTGTGGAGACGTTCGAGGGGATCACG
TACGTTACTGTAAAGGGAGCGGGGCACCTC