Description :
From Genome Similarity Track
Location :
Scaffold_17:211668- 218787
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007121Protein of unknown function
Pytul_DAOMBR144PYU1_G007120Protein of unknown function
Pytul_DAOMBR144PYU1_G007119Protein of unknown function
Pytul_DAOMBR144PYU1_G007118Similar to spas: Spastin (Drosophila yakuba)
Pytul_DAOMBR144PYU1_G007117Protein of unknown function

Sequence
7119 bases(100 bases per row)
TGCAGCTTCGCAAGTGTGTCGAGGAGCTCCAGAGATCGCTCCAGAACAATGTTCGACGATCGTAGGATCGATTTGGACGCATCAAGGGTCAGATTTGCCA
AATGCGGCATTTGTGTCAATGAAATCCCTGAGATCACCTTTTCCACATGACGAGCCTATGCGAACCACAGCAAAAAATTGTTATTGGCTATGACACTGTC
AAAAACATTTCAGCACAAAATAAAACTCACCTGGTTCATGACTCCTTGAACTTTTCGTGTGATAGTATTGTAGCTGCATGTCATTTGGCCGCAGACTTGC
GGCAGTGTTTCTTGCGCATCAGTGATATCCAACACGCCTGATGTGTGAATGCCTTGCTCGGGCTTGATGTCCTTCACCGGCACAAACGCGAACAATTTGG
CACTGAAAGTGCATTGCTCCACTTGCTTGAAGTCGTAAAAGTGTGCTTTCGTGTCGCTGTTTTTCGTTGGTACCAGCTCCACTGAGAGAGCCATTCGCTC
CCCGCTGTTGCCGCAGGTATCGCCGTCATCGAAAAGCATGTATTTGTATCTCATATTAACCGGATCAATTTTCCATCCGCGGAAAATGCTACACGATGCG
CAAAGACGAATTCGATTGTAAGCACTCAAATAGCCTAACTTATAGCAGAAGGATAATTGCCACGTACCCAAGAATCTTCCTCATTGGTGGCTCTGAACTC
TCAGCTTCCTCAGCCCCCTCTGCAGCTTCAGGCTTCTTGGCCACATACGTAACGTTCTTCAGATGGCAGAAGTCAACAAGCGCGCTATTTACACACAAGA
TCAAGTTTAGCGCACGCGCTCCACGACATAATAAACCAAAGGTCAACAAAGTTATACAGCAACAACAACCTCTCCGTATTGATAACTCCTGGATTCTCCG
TCAGGCATTCCAGCGAGTCGGCAGAGGACGTGAATGGACCTACACGCAGGACATCAGACGCATGTCGTGTTACTAAGAGCGAGGCAAAGCGCATCGATGG
GGAGAATAAGCGCAGGACAAACCTTGGAAAAGCACCACGGGCTCTCGGAACGGCACAGGTCCCTGCGGGCCTTCCTCGGCTGGATTCGTTCGCGACACGA
TCCGGATCCCGACTTTCGGAGCTGCCGCGCACAATACGCTCGTGATCATCAGAAGCACCGCGATGTACATCACACTAGGCGTCGTCCTTGGAGACGTCAT
TAGCCGCATATTGTCGCCTCTCTCAGTGGTTTTGCGCCTCTTTCGCTATCGAAATGCTTCACGCACGTCGACGTGGCTGTCAAAACAGAAATGAGAGTAA
CGCAGGTACTGTAGCTTACTGGGGAATATATTTGTGGAGGTATATGTGTTTTTAGAGGGTTTCCTTTTCTTGTGTTGAAGTTCGGAGTGATGGTCACTAC
TGTCGCCATTCCGCATTCTTTCCGTGTCTGCCATTCCGCATTTTGCCACGAGCAAGAGAAAGATAGGCGTTGAAAATGGACACCGTAATGGAGGTCACGA
AGCGCGTTGAAGCCGCAAAGGTTGAGCTTGAACGGTTGGCGCGATCAAATAACAAGCGCAGTATTGCAACTTTGAATGACAAGACAGAAAGCGCCGCCAG
TTTGCAACGAATCATCAACGAGCTGCAGCAGCTTGTGACCGAGTTTAAGAACATGTTTGTGTTAGACAGGTCGAGGAGCTCGACGCTGATGGAAGCTGGC
ATAATTCTGTACAACGCTTCCAGAAACGCATTCAAAGCAATGCCGAAGAGCTCAGTTATACAGTGCGACGACAAGAAGGACGAGGAGGCTTCGAAGAGAA
GACACGAGACAGAGTTTGCATTGCGGAATTGGGTTGTTATGGCAAGGTTCTGGGCATGCAAGATTATGAATCTATCTCTAATGTGCTCAAAAACCGGCGG
GACATTGGACCAGAGTATCACCAAGAACCAGCCCCAATACCTCGATGAGTGCATTGATGTGCTGCGATCGTTTGGGCGTGTTGGAGCGTTATTTCTGGAG
AGTGCGAAGCGTGACTTCGGCCGATGTCAGCACTACTTGAAGATCGCAGAGGAGTCGTTTTCGTGCTGCTTTGCAATTTGGTCTCAACTCGGGTTATCTC
ACTTGACCAAATTGAAGCAAGACCTTGAGCTGGAGGAGATCATGGAAGATCTATGGGACTTCAGCATGGATCGAATTCGAGTATTGCAGCTGCTTTGTGG
CGATGACGATGCCTGCAAGTCCAGAGGTACAAATGGAGTTGTCGAAGCACTGAGTGAGTTGCAAATGCTCGTTCCGTACATGCCAACATATAAAATCGAT
TTGCTGAAGTTGGTGAAAGAAACAAGTGAGATTTACAAAAAAGCTGGACGACATCAAGAGCAAATCATGCTAACCGAAGAAGCTCTCCGCCTCTGTGATT
CGCTAGACGCATGTGCGGAGTCAAGTGAAGAACATGTACTGCAGCAGTTCAAGCAGAGCTTGCTTGTTAACGTGCTAGACACGTTTGGAGCGATGAAAGA
CCATCAAAGAGCAGAGACGTGCTATTCTCTTCTCCCACAAAGTCGCGACTCTGCGGCCGTTTTTATCATGGCGAAGATTTACATAGAAGCGCAGAAATAC
GACAAAGCTGCCTACTATCTCAAGATCTTGTTTCAGCTAGACAATCTCGAGTATTCGAGACAAGGAGCTCGACTTTATGCTCAAGCGCAGTCGTACGATG
ACAATTCAATGAAGATTTATCAAGAGCTGGAGCGAAACTACGGAGAAAACAGACTTGAGATCAACCTCGATCTTGCATGCAATCTAGCTTTCTCCGAGAT
CCCCGAAAAGAGAGAGCGCTCGATAAGCGAACTGGAGAGAGTCGCCACCCACATCAAGGAAAACGAAAGGTACAGTGAGCATTTTTGCCAGATATTGACC
GTGTCTAACCGGCAATTTATTTGCGATTGCGTAGAAATGAAGGCAATAATGCTTTCTTAAAGCACGTTGAGCGGATACATCAAACTGTGCTTGATGCAAC
ACAGCACCATTTGAACCGCAACGCTTACGAGGTAAATTGAGCTCAATATTTTGTTTCACCATCACTTCGAAGTACATTTTGTACTGAAAAAAATGTGAAT
AAACAGGATTGTATGAAATGGGCGAAACTGGGTACCGACATTTCTTTGACTGAGCATGAGACCGGTATATACATGAGGTTTGTGTTTATATCCACTGAGG
AATTGGGAGTCCTGGAGCAAGCTTCAACAAACTGTTTTCGTTGTGTAGAATACTGTCTTTGTGCTACCTGCGGCTGGATCAAAAAGGAGACGCACTAGAA
TGGGCAAACCGAGCTTTTGCCACAGACCCATCTAAAAAGTCACTGTTCTCCCTGTTCAAAGCAGAAGTGGAGTTTATGGAACCCCAGTCAAATGATAGCA
TTATAAGTATCATACAGCGACTGAAGGACAGAGACGATTTTGAGGCTCAAGATCTACTTGCACTCGGAAAAGTAGCTCAAAGTGCCGGTCCAGCAAAACA
GACAGCAGTTTTGGAGATACTGGACGAGTTGTGTACTCTTGCGCTTCGAAGCCCGGAAGATGCATTTGCGGTTCCCATTGTCATTTTGCTTCAAAACACA
GCGCAGCTCGCGTACACTTGTTCAGCTCAAGCGAGCTCAACTGCAAATGATTCATTACAAGCTGGTTCACCATTTGCGAAAAAGTTTGAGAGCTACGCAC
GCATGCTGCTTGAGTTGCCGAAGCACACATCACAAACCGCGGCACACTCCTCAGCGGTGTATGAGTGGTTTTATGCAATGAGGTACGAATATGTGATCGC
ACACGTACATGATAGCCATATTCTAACACTGTTCCAGTTTCAATATTGCAAAAAATGCAGACTCCGGTGATATGTTTGTTTTGGCAGCAGAAATCGCAAA
AGTGTCGGACAATGTGCTTCAAGAGAATTCCCTCTTGCACCAGCGTCAACATCAATGCCTGCTGGCTGCTGTTGCGTGCGATATGAAAAACTTGGAATGC
CTCGACAAACATCAGCTGCATAAACTGCTTGAGATTGTTGACCAATGCGAAGCCTGTCTCGGAAATGAGGAATCGCCTTCAGATAGTGAAGTCGAATACC
TGGTACGCCGATCTTTGATGGCCTTGCTAACCTCACCTTGCAATGCCCCTCCTCTCATACTCTCGCTTCCCACAGGCAAAATGTGTGTTTGCGATCAAGT
TGCGACTCTTCGATCCAAACATTGATGGGATATTCAACCTCTGCCAAGCAAAAATGCGAAGACATGCCGACGAATTCGCTCATCTTGCAGGTACTCATTT
GCGCCTATCTAGTTGTCTGTCATGCGGTATGAACGCAGCATCGTTCTCACACGTTCAGCATTACGTGAGTTTAGAGTTTACTTTATATGCGGCGAAGTTT
GATGAGGCATCTGAGGTTTGTCATTCCATCTAGTTGGCATTCGCGTTCGCGGGGTTTTCTTACTTGGTTTATATCAGGTCAGGGGGAAATACAAGCAACT
CGCAAGCAATCTGTTTAAATATGGGTAATTCACCATTGCTCAAGCGAATATTAGGATAAAGAAATTCTGTTTGTGCTAACTTCTTGCTGATAGGCTTCAA
ATTATGTTGCAAGGCGACACGATTCACCCAGAGAAACTGTGCTATTTGTTCCGGCGGCTCATAACCCTCGCTGAATCTAAATCCATCGCATTCGAATGGC
TTGAACAGTTCGTTCAGCTTGCTGGTAGCTTGGATGTCACCATACCAGAAGATGACATGGAGTGGCTGGTGGCCAAAGCATGGAACATTGTGAGCAACAT
GTGCATTCTGCTTTGGCATACAAAGATGTCGAGTGACTGACGTCCATCTGCAATGCCAGGGAATTTTGTTTCATCGGAATGAAGCATTTGACGAAGCCAG
AAAGTTCATGAACGTATCGATGAGTATTCTTGGTACGTAGATAGATGTGCGTTGGCATGAGCTTCTGATGATACACTAACAAAGCCTGTTTTCGTAGAAA
AATGCGATGAGCTTGCAAAACGATTGAGGCCGGATCTGCAACTTCAATACCAGCACTTTTTAACCTCGGCGGCACAAAAACTACCCGGGAAAAACTGAAA
AGTTTAATTTGATCGCACTAATCACAGCAAGCTACAACTACATGCGGATCAAATCACGCTTCATAAACATTCGATTGCGACCCATGTTGGTTGATCCCAA
GGGTATGGATCTTCGTTGCTTCCATGTACGCTTGAAGAGTTGGGACCTCTTCTGTTTCTTCTTTCTTGAGCACTTTCGAAGCCCATTTTCGTTCGGCATA
TTCGCAAATCTGGACAAAGAAAAAATCATGAGTATGCCAATGAACAAGACTCTTCTCGTTCAGGTTGAAAGATTAACCTACCTCTTTGATATCACGACAC
GAAAGACCCGAAGAAATCAGCGCTAGCTGATGCAAATCCTCGGAGGACAGTTGTTTCGCGTATCTACAAGTGCGAGTATCTGTCAGTCAGCTACCTCAAC
TCAATACGCGGGGCGAAACTTCTACTTACCGTCCAAAGACTGCTTGACGGGTGGCTTCGTCCGGCAGGTCATATCGAATGCAAAGATCAAAGCGGCTGAT
CAAAGCAGAGTCCAAGTCTTGCTTCCTGCAGATCACAGCAACTCATTGTTAACGTGCAGCTCGCTCAAGTATACTCTGTGCAACGCACGACGTACCTATT
TGTTGCGCAAACGACCGTCGTTTTCTTGGCCGAAGAGAACCCTTCGACTTTTTGAAGCAGCACAGACAAAATGCGACGCGAGGCTTCATGCATCTGACCT
CCAGATCGGTCCCCGGCCAGTGCATCGATCTATTCACACACCATTCATCATGCACAGTGTCAACTATGTGGCTATCATGCAAGAATAAAGAACTGCATAA
ACACCCACTGACCTCATCGATAAAGATGATCGCGCCGTCCAGTTTTTCACAGGCATCAAAGATCGCCGACATCTTCTTTTCGCTATCGCCGTACCATTTG
GAGACAACGCTTTCAATCGGAATGTGGATCATCGGAATGCCCGCTTGTTGCGCGATGATTCGCGCGCTCAATGTTTTTCCAGTGCCAGGAGGACCTTCAA
ACAGCACGGCACGCGGTCGGTTGCTTTCGTATCGGCAGCGGGTCTTTCGTGCAATGTCTTCATAGAGCTCTGGGTTCTGCAGGGCAAGCACAACAGTGTC
TTCGATCTCGAGCTTCACTCTATCGTATCCAGCCTAAACGATCAAGAAAGCAGGAAAGAAAACACAGGCAATCAGAATTGACGTGAACACCAATAGGACT
CCCTTCTATGAAAGCTGCTTGAAGCTTACCAAACTATCCCAGTTGACTGTGTTATCTCCTTCCGCAGCTTCAAACACGTCGATACCAAGCTGCTGGAGCT
GCTGAATCGCCTCGTCCTGCTCACAATGTCCATGTGCATAGGAGTAACAATGAGAACACATGGGTACGAAATGCAGTACAAAGCCCACTGCGCCCTACCT
TGGTCGCAACTGGATTATTCGCGTCCGGACGCCTTGGACCACTCCGATCCGCGAGAATCTTGCGTCGCGATTGGGACATATCGTGTCGGAAAAACGCGTG
CACGTGCGGGTACGAGTAGATCTCCTTGTACGCTTCGACAATCGCATTCACCTCGCTGCCCGTGAGGTACTCATCTTTGTAAAACACAAACGTGGTTCCC
TGGTTTGGCTGCATGCTCTTGTCGCGCACGAATTGGAAGGATCCTTTCCCATTCACGTACAAATACGTTACCGACGGCTGGTCATAGTTCTCGACGATCG
ATTTCTGCTCCGCTTTATCGAGTGGCACTGGAAAAACCTCGACCGATTGCCTTGTGCTCGGGTTCTTCTGTAAATTCAATAGAAAGCGCCCCAGGATCGC
TTCTTGGTCCACAAACGGAGGACACATAAACTCAATGCGGATCGTGGACACGCCGTTGGGCGCATGGATGCGCGAAATGCCAATCTTTTTGATCGGGAAC
GCCTTTGGTACGCGCGTGTCGGAGCGCTTCAGCGTCGCGCGAAACTCCGAGACGTGCTCCCGAATCACATCGACTAATTGCGAATATTCATATCGCTACG
CAAGCAAAATCACAATACA