Description :
From Genome Similarity Track
Location :
Scaffold_11:211662- 213870
Sequence
2208 bases(100 bases per row)
TAATAACATGTATAAATTATTCAAGTCGTTAAATTTAGAGAAGTGCAACTAATATAAAAACTGTATCACATGTTGGACAAACAGAATATTAAATCTTACA
AGTATGTGATACAAGAGTACGTAATTTTGTCCTATCATCGTCCATGGATGATTGTGATTGGCCATTTGCTGGCCGGGAATTGCATTGGCCAGGAATTACA
TGAATCACCTTATGTCTGCACTATTGACTGTTTACATCAATGCCGTTTTGTGATGTGACTTTTCATAACAAATCCCTCATACAAAAATCAAGATAATTCA
TAATTCAATATTCAAAATCAGTCCGGTCCGCACTAATTCTCCAAGCCCATAATTAGTGGGATTGAGATATAATTTACTACCGGTAGTGCGGTCTGCACTA
ATACATGTGCCGTAGGTCTGGTGACGAGGTTGAAAATTAGTGCGGTCCACACTAATTACGGTCAACGGTGTAGCACATATATGCCGGCCTGGTGGCAAAC
ACAGCGTGTGATTTACCATCACATCTGGCCACTTTTTCAAACTTTACATTTTTTCATACAGCACAGCAAAAGGGAGTTCGTGGATTGCCATTGTTCATGG
ATAATAGAGCCCTAACAAGCAATCTCCAAACAAGACTGAACCCCCACAACAGGAAACAGGTAACTAGTTTGGTATGTGTTTTGAAGGTACAGAGAACCCC
CGAAATATCCGAAAGGGGTTGCAGCAAATTTGGATGTCGCCAGAGTAATAATATTCATTACTTTTTTATTGTTAGATATGATTGGTAGAAATTACGAGCG
TAACGTTACATGAGGAAATATACGGTATCGTAGATTTTGGAAACTATAGTAGCACGTAAAACATGTGAATAGCCAGCCATGAGGTTAACTAACTTCACCT
CTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN