Description :
From Genome Similarity Track
Location :
contig_59:211647- 215624
Transcript NameFunction/comments
g9008.t1hypothetical protein

Sequence
3977 bases(100 bases per row)
CCGCGATCGTTTGATGCGACAGGATGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGAGTTTCGTCAAGCATTCTGGGAGTCTACCCACA
AGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGGCTCGGGTGCAAACAGCGTCGATCTCGCTGGTCCCCGGTGGCAGA
CCATCCTCAAGCATTACTGGCTGGGATGATCGCTGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCTTCCTTCATTTTCCGCGCCAAAACGAACGG
TGCTTTTGGTACCCCGGTTGGAGCCACGCGGGCGCCCCTGACTTATCAACGCTCTTCCTACCGCCGATTCTGCCGACCCGTGGCGCAACCAATATCGCAC
ACAACTGAGCGATCATCCCGGGTCCCGCATCGCACGCCTAGACGGTAAGTTTCGGTCCATCGTCGATTCTGAGTGAAGTAACCCTCTCCAAGGTCTTGAT
AAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACCCGACCCCGATCGGCCTCTTCCTTCCCCGATCGCAAACTCACAATCACA
AATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTTCCCCTTCA
TGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTTCGTTCAAAGTCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGACCCAAGTTGGA
TCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGGTGGACTCGTCCATAGCGCGTCCGGCGGCCGGTTCTTACATCCGCGATCTTCTCCACTTCAAACT
CGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCCTCCGGCAGGAGGGCTTCATCGAAATCCAGGCGATCGCTCTCGGCCACAAGCAACGGCGCGTCAGGACG
ATCGGGAAACCTCCGGACCAACTTCAATTTGGACACATGCACGATCGGGAAGATCCTATACTCCGAACCCGCGATCTCAAGACGTGCGGCGTGATCGCCG
ATCATCTCGGCGACACGAAAAGGTCCATGCCACAGGTGTGCGAGCTTCCGTGCATACCCCTCCTTGACTCGATCGAGGTGTAGCCATACCTGAGCGCCCC
GCGATGTTGTGGGGCCGCAGATCTTCGTTGTGTCGGTTGGCTCTGCCTCTGATCGCCTCGCGCAGTCGCTCGCGAACCTGTTCCCGCGCTCGCTGGTAGT
GTTCTTGTACGTGGTACCTCCATCGACGGGGCTCCTGATCGCGTCGGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCGCGGGTCCCACCC
ATGGGCCAGGTAGAATGGCGTGTCGCCACGAACTCGATCCTGGGCCGTGTTTAGAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTC
ACGTCTGACACGTACATCTTCAGCGATCGCGTTAGAGTCTGCACCATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCGGTACGCCATCGTAGCTCTCTGTT
TCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTGGCGCCGAAACGTCGAAAGAC
GCATTCTCGTAGTTCTCGGCGATCGTTTGGGCAGTGCGAGAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAAAGGTCAACCCAGATTAACAGCTCTG
TGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGTCCATGGCGATCATTTGGAATGGGTACGTAGCTTGTACATTCCCTGGCGATTCTCCCTGAAT
GAGGGGGCGCCCTTTCCCAGTTTCACAATCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCTTGACACGC
TGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGGTAATGATGCAGGACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGCGCGA
GGGAGTCTCGGTCTTCGTCCGATTGCGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTT
AGCATCGTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTC
TGATGCGTTGCACGATCGCTTCTTGCAGAACTTCCGGCGTTCGTCTCGACCGTCGTGCCGATCGCGTCACGAGTACAGCGTTATTATCCTTCGGCTTCAG
GAGCTCGTCCAGCCGATTGAGTGATCAGGTCCTGCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCCGTTGAAGAGCTTCGCTAGCTAACTTGTCCG
CGCTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGGGC
CTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCACCGCAGATCACGACCCGCCCCCTGTCCATAGTGGACAGGAGATCGAAGCAC
AACAACAGTCCGCGGTATTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCTTCCACACGATCG
CGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGTTCATCCGCTTCGACCGTAGGGGGTGGCATGGTGATC
GTCTGCGGGGCTGCTTCACTGGGGCAATCGCGATCAACGCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCAGAATTCATCCTCC
CCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCCACGCCA
GCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGACTTCCTTGTCGACAATCC
CGTAGTTGATCTCGTTGGGTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGG
CTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATTTCGC
TCGGGCCCAACGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCGGGGATGGACCTGTTCCTGAACCTATCTCGTGGAAATCCG
CTTCGCGCAGCTCGTACAGGACAGCGGCATAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAG
AGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCCACTTTTCGT
CGGCCCCAGAAACTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTTCAACCTTCTCACACAGCATGTCCCAAGTGATCGC
AGTCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGGTCTCGGCTCTGGTTCTGGCTCGCCTGAATCGAACACGTCGATCGGTTTCGAC
GGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTATCAATCAATCGCTGGTAGATCTGTGGCGCATT