Description :
From Genome Similarity Track
Location :
Scaffold_2181:2116- 3464
Transcript NameFunction/comments

Sequence
1348 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAGG
TTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCTTTTGCTATGTGGAC
GACCCTGTGGAGTGGTCAACTTGAATGTATCCATTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGACTGTGTAGCACTGCTACACCGTACCTCGGCG
GCCAGCGATGCTAAAATGACCAACGCCGCACTTGCAATTCGGCTGCCTCATCAGGAATCCAAATCCTCCCCTGTGCATCTTTCGAGAGTTCATCATTGCC
CTTAGTGACGCCGGGAGGTGCTGCAGCAGCTCGTTGGGTAGTCACAATTTCTAGCCGTGTTGACTAGACGAATGTGTCATCCAGTTGGGGAGAAAAAGTA
AGCGACACTTGTCGAATAGCGCAAATTATCTTAAAGGTTGAGCCCCATTGCGACAGAAGGTCCGCCCGGTTGTCATTCCCCACGATGTCGTGGATCTCAT
AATTGTAGCCCATCAGCAGTTGTGACCAACGGTGAAGCTTGTCTGCCGTATACTTTAGCACTGACTTGGAGACGCTGTCTGAGTCAAAGATATATCGGAG
ATTGCGATGGTCGGTGAATACTGCGAATCCATCTGGACGATGCAACAGATAATCAGCCCGGCGACACATTTCAACAATCGCGTACGCCTCTTTTTCCACT
ATAGCCCATCGTTTGACGCCCCCCGAGAATGAACCACTCAGCATCATCAACGGCTGGTGATCCTGCTCAGTAAGTGGGCGTGCGACCTGATCTCGTGAAA
TCTGAGTGATTGCTGCTCCCCAATATTCATCACTCGCGTCACAATAGACTGACAGACACTTGTCGGGGTCTGGATGCGCCAACAGCGGTGTATTTTGTAG
ACAGGCTTACAATGTTCGATACAGGCCGATTCATCATCATCACCCCATCCAACATCACTCAGTTTTACGGCGCGCACTTGTGTTTTCTTGCGGCCACCTG
CACGCTCGTAGACCCTCTCCATAACTTTCACTAAAGGATCCACAAGTTTGTTGAATGCGGGTAACGACGCCTGCATCCAGTTTAGTGCACATACAAACTG
TTGCAACTCTTGCCATGTCGCCGGCTCCGGTAGGTTCGAGAGAGCCGTAATCCTAGCGGGATCATGTCGAGCACCACCCCCCGAGACCACGCGACCACAC
TACAGTGCTTCGCGAAGGTAAAACCTGCATGTATTCGGGTTCCGTTTG