Description :
From Genome Similarity Track
Location :
scaffold_60:211529- 233979
Transcript NameFunction/comments
g6729.t1 endo-1,3(4)-beta-glucanase, putative
g6730.t1hypothetical protein
g6731.t1 hypothetical protein PHYSODRAFT_469149
g6732.t1 hypothetical protein PHYSODRAFT_294124
g6733.t1hypothetical protein
g6734.t1 conserved hypothetical protein
g6735.t1 conserved hypothetical protein
g6736.t1 hypothetical protein PHYSODRAFT_475141

Sequence
22450 bases(100 bases per row)
GCTTTCACGATCCGGATAAATGTTCTCTGGATTTTTACTCATCCTCTACTTTTATCCGGACAAAAGAGATCTTCAAACTGAGATCTTCACTTTCCAAGCA
GCCACGAACCCGTCAAGTCTCGCTGCCCCACCATCGCAATGTCGAACGAGCTCTTCCCATCAGCGCACTCCAATACTCCATGCTCCTCCGCGCCGCCTCC
GCCGCCACTTTTCCGGTCTACGGGGGACCTGGAGAAGTTGATTTCGCCGCATTTCGTGGCCCCGGAGGCGCGGCTGAAGCCCATTCCGACCAACGAGTGG
TGGGGCAACTTGCTGGCGTGGGACGGGAAGCGGGAGAGCGACGCCGTGTTCGCGGGGCCGTACACGTACAAGGTGGTGCAGGGCCAGGCTGGAACCATTG
GTAGCGGCCTCTCGGTCAGCTACTTGCTGCAGTACCGCACGGACGGCCCCATCAACGACAATGGAGCTCCTCGCTTCTACTTCTACCCGCCGACTATCAA
GAACTGGATCTTCTCTGCTGTGGAACTGGCGGAGCAATCGGGTACAGCCCCTCTTAGTATCCAAGATTGGGACGATATGGGGGTGCGTCTCGCCATGGCA
GGCATGAACATGTACTTGGCCTTGGGCACCGCCTTCACGACGGTGGAGTATCAGGACATGCAGGTGCAACTTGGCACCGATCATTGCATTGTCGCTATCG
ATGGAGCCCCGGCTAGAGAGGGGCACCAGGTGAACGGAATCAGTTTTGTAGTCTCACTGAATAACGGACAACAGTGGGTGCTCTACTTCTTTTCGAACGC
TGGGGGCAACACCTCGCTGGTGTTCAAGGACAACAAGCTCACGACTACGTCGAAGTTCACGGGAGTCGTGCAGGCGGCGTTTGTGTCGACAAGTGCTGTG
CAACCTGCGGTGCCGCAGGACGACCACAAGATCCTGCAACTTTACCATGCAAGTGCAGGGGTCTACCCGAGAGGAGTCTCCGTCCAGACGTTCGATTCTG
AGTCGTTTGCTTTCAACTGGCAACTTGTGAGAGCCGCAGGCAGCAACCCGGGTGCACGGTTCCTGCACTTTGCACTCACACACCTTCAGGCGATGCTGGA
TCCGTCTACTGCTGAAGCTAAGCACGAGCTTACACTGCACTCGCATACTCATGGACCCCTGTTTGCGTACGCGTTGGTATCTCCGCCAGATTCTAATCCA
ACGTGGCTGTGCCACGTGCTGCAGGCTGAAAGCAAGGGCATCGAGACGTGCACTGCATTTTACCCACCTCATGCCGGCTCGATCACGCGTGAGGTGGTGG
AGAAGCTGAACTTGTGCCGAGTCGTCACAGATGAAATTCATGGGGATTGGTCTTTGCCTCGTGAAGGCAGCTACTACTTCAAGGGCAAGGCGCTGCAGAA
GTTTGGCTCCATGTGTCTTGTTGCGCAGCAGCTTGCTGACACAACCAACCCAGAAATGAGGGAAGTGGCTCAACATGGCATTTCCAAGCTGCAGAAGTTG
TTGGCGGACTTTGTGAACAATCAATCAGCGTTCCCACTTGTCTACGACACAGTGTACAAGGGAATTATTTCCAGCGAAGCCATGGCTAAGAACGACATGA
ATGTCGATTTCGGCAACAGTGTGTACAACGATCACCACTATCACTACGGCTACATTGTGACCGCGGCTGCCATGGCCCTCTACTTGGATGCGACGTGGCG
TCATTCAGCCGATGCTGTCAAGGTGCGCACATTCATTGACACGCTGATCCGGGACGTTGCTACCTCGTCGCCTGCCGGAAGTGACCCGTACTTCCCGCGC
TACCGCTACTTCAACTGGTGGCTAGGTCACTCGTACTCACACGGTGTGACTCCAATGGCCGATGGCAAGGACGAAGAGTCAACGTCGGAAGAGGTTAACA
TTCTCTACGGCATTGCACTGTACGGCCAAGTGACGGAGAATACCGAGCAGGAAGCGCTGGCAAAGCTGATACTGAAGGTCTATGTGCGTGCGGTGAACAC
ATACTTCTTGTTGCAAAATACTGGACCTAAAATCCATCCGGCGGGCTTTTCAAAGAACAAGGTGACGGGTGTTTTCTTCGATAACAAGTGCGACTACGCA
ACGTGGTTCAGCCCCAACAAGGAGTGCATTCACGGCATCCAAATGATTCCTGTTTCGCCGATTCTCGAAGTCTCTCGAGCACCGAGCTTCGTGCGCGAAG
AATGGGACGAAGTGCTCAGCAAACTGCCGATCGTACACGACTGGAAGGCGAATCAATCTGGCTGGACCTCGCTGCTATTTGCAAATTACAGCGTTCTTGA
TCGAACCAAGGCTTTGGAGGTGCTATCCCAGTGCCCGATGGACGATGGACTCAGCCGTGCTTGGGCCCTGTACTACGCAGCCACCCGGCCGTCACCCCCC
TGCTACTAGCAGGCTGCTAGTCGAACCTCGCACGCAGCTAACCCAGTCAAATAAGTCTCGTGTTTCGACCCCCCATTCCATTAGCCACAAATCGCATCTC
TATCTGTTCATCAAAACTGTTGCACCTCTTGTGGTTTGCCTCTGATCATCATGAAGAAGTCATCGCTTGTAGCAGGGATTGAGCCAAGTTGCTTACAGCA
GGCGACACTTGTCGGTCACGTAGCGAAATTAAACAACTGCAAGCCGTGAACGGGTTAGACGATGCAATAAATATGTAATCAGCTGAGCTCGTACCTGTCG
ATGAGACGTTGAAGCTCTGCTGGGGGCAGTGCTCCAATAAAGGCAGGTAGTTTTCCGACGAGGGCCCCCACCACCTTTAGTCCGCTCATTGCAACGGACT
CACTTTGGGTGACCTCAAGACGAGCTGCAGCTATCTCGAAACAGATGCGAACAAGCTGCAGATCGGCGTTGTTTTCCATGGAGAGCAATTCGCTGGCCTT
ATACAAAAATGCAAAGATGACCTGTAGCAGTAGACACCGCATGAATGAAGATCAGGCGAAAAAACTCAAATGACTTTGGGGGTAATACAGCCATACCTGC
AGCCCGCCAGCAACCACACCGTCTTCTGAGCAATGCTCGATAGCTAACGCTACGCGCGAAAAGAGTCTCTGTGCTTTCCAGCTAGCGAGCATATTGTTAT
CGGATCGGGAGATGGCACTACCAAAGCAAGCAATAAGTTAGTAGCCCACACGGATAAATCGATGATCATGAGACTGCAATTAAAGTGTACCTGAGTAGAA
CGTTACAGCAACAAACGCGGAGTTGGAGAGGTAGATCACCATGTCGAATTTCACTCCATACGCTAACGAAAAGCGTTTGCACGCGCGAGCCAAGCGTCTT
GTGGTCGTCGTCCGTAACGTGGGGTTCATCCTTCGTGCCCCCGAAAATCCAAACTACGAGAAGGTTCAAAAGTGACGAGCCATCCGCTGTAGGCAATTTC
GTACTGTCTTGCTCGCATTCATCTTCAGTAAGTCTGGTGAGAATTGACGCGATGCAATCAATGCACCCGCGCTGGAGATCAATGAGCAGTGATTCATCCA
TTGCGAAGCTTGAACCCGGAGCACACGGGATCCCCAGGATTTTGACCAGCACGACAAGTGCTTTCGAAGTGATATCTCCGTTATACATGTCCTCTGAAAA
CACCCGATTCAGGTAGTAGACCATTAGCTTGGCCGTCACTAGCCCACATACATCCGGAACGATTTCTTCACTAACGATCAGGGAACTATTTTGCTCGTGG
TGAGGTGTTGCCTCCCGCAGGAAAGCAATCAGATACGCGAACGCGAAGGGTAACACAAGAGGCGGAGGGAATTTAGCTAGTCCCTCCGTAGCGAGCATCT
TTACCTCCTTGAACTCCAGTGGATCGACAACGGAGCAGGCTAGGATGTGAAACAAACGTTCGTTTGTGACATCTCCATCGCTTTCTGGGGCTGTCGCTGG
ATCATTATATCGCTGATGGTCGATATACTCGTTCAGGTGGTCTAAATCTTCGCGCCCACACTGTATCACACAACCACATCAAGTTAATATCAACCTGGGA
AAACAGCGTACAGGAGAAGTTGCTCACCGCCAGCGTCGTAGCACAGTTATATCCAAATATCTGTCGCGGAAGCATACGTAGCACCAAAAACGGGGCCAAC
CGAGAAAACAATAGCCCCTCCGTAGCTTTAGCAGCCGAGGAGGATGTGTCGTCAAGTAGGTCTTCACTTAAACGCTGCAAATTCTGCAGCATCAAGTTTC
AAACACATCGATTAGAATTGGGTACAGCTATTTAGTGCTTGCGGCATCGCTCGAAGTTTACCATCATGTGAGCGGTAAGCTGCTTTCCCATCGTCTGAAA
TACAGCTTCGTCCACCCAACCACACGCCACAAATTGCCGTAGCATCCGGAAAAGTAGCGTATCACGAGGAGAGCCAAAGATTTTGCGAAGGAGAACGCTT
AAGACCTTGCAGCGGGCATTTGCGAACTGAACGTACTTGTTCCACCTGCGCAGCCACACATAGAGCAGCGGTATATTTTAAAAGAGGAACACGGCATCGG
ATCAATACAGCGATGCTCCTACGTACCCGTTTGGACCAAAGCACAGCAAGAGTAACTTTTCTTGTAGCTCTTCTAGCCCATTGTTATCTTTGGTGTTCCC
TTTTAGTAAGAAATCGTATTCGTTCCAATAACGGGGAGATCCAGGGGCTTCCGACGAGACCTTCGATGTCTGAAGGCCCCCAGACTGACAAGCATCAACG
AACCATGTCACCCTGGTTTCCAGCGAATATTGCGACGATGTCGCGAAAAAATACCCAAGCACCGATGTCACTATGAGGTTTTCAGTGTCGTGAACACCAG
CTGCACACAATCCCGCAATACATGACATAGGGTCCAGCGACGGTAAGCAAGAAAGTGCCTAGAGACAAGTAATATGTTAGTCTCCATTTTAAAGAGGAAC
ATGTGCACCACACGATGCAGATAGTCTTACCAATCGCCGAACATGATCATTTTCGTTGTCAATGAGACCTAACAGTACCGGTGTAAGCTGGCGCCTGTTC
ATACAGGAATACGGCGGTGAAATCTTCGTTAGCTTCATTATGAGCACAGGGACCATTAATGTTGTCAGCAAGACTCCTACCGCCAGTGTCGATAGAGCGG
CACTTGAGTGTCTGCACCGTCCAGTTGGTAAATGAATGTGCGCACGAGAGAAATGATTTTCTACACAACAGACAAAGTGCACAGCAAAGCAAACATATTG
TTAGCATTGCAAAAAATTGCATCAAAACATTTAGGGAACAACAATGTGCTCACCCGAATTCTTCGAATGTGAAAATCTTGCAGGTTCACTACGATCTCCG
TGATGAACAGTTCTCTCGATATGATGAAATCTGCCACAAACAACTCGAGTTCCGTTTGATCTTGTGATCCATTTGCAGTGAACTCTGAGTGAACAGGAAC
TGCCAATTCGTTGTCGCAAAGACGAAGTAACTGCGAAAGAAGCTCTTGTTCGTCGTCGTGCGTGGCTAAAAGACCGAATGCATCACTGGGCAAAAGTACA
CTTCGCAGAACTTTGAGGATGAAACAAACTGCTGCTTCATCACTTTTCTTGATTGCTGTAGCCATCCCTCTGACGAAAATGAAAACGAAGTACTGTTTCG
TTTCGGTTGATAAGCTCTTGAATGCTTGCGAGCATCCTTTGACACCACCAATAGAGTCCAGCAATATGCAGATGTAGCGAAGTTGGGCATACAGCACTTC
ACGATTGGTTGTGTCGCGATCAGTATTTGGTTTGATGTCCAAAACGCTCAAAATCCACCTCTTCAGAGCTCGAGATAGAATTTCGGACGGCTGATTGTTT
TGAATTTGAGACGATGCTTCACTACGCGTACACAGCAGTGAGGCGGTTGCCTCCCAGTGCCAGCACATCATATCCAGCACCACTACCTCATTTAAATCTG
ATCCAGTTGCGGCCTCCCCATGCTTGGATAATAAAAGCGCATCGCACGCTGTAGCGTACCATTGGAGGTGCTGGAGTGCATAGCTGAGGAACTCACGTCG
TGTTGAGTCTAGATGCCACTGCCGTAACACGGTTAGGAAAAACCGCACGCCTGTCACCATTTTGTGCATCAACTCCTTGCTGGCATAACTTCTCTTTGTT
GCTTCGTCCGACATCAAATAAATCGCAGCAATGTCTCCACACAGTAGCGCAAGTGCTTCCAGGGCAATCAACGCAAGTTTGGACAGCTTCACACGCTGCG
AATCAGCAACACGACGTACTCCTCGCTCAATAATACCACGCAGAGCATCCATGTACGCTTCAGCTCGATCACCCAGCAGAAACGGGCATTCGCTTCCAGA
AACAACAGTCATCATCTTCCGACGACGTCGTTGTAGCAACTCGAAAAGTGCAAGACAAGCAGCCAGCTGATTCTGCTTCTCGGCTATCGGCTGGATCCAA
TCCAACAGAAGCTCCCGCACAAAGTCATGACTCAAACTCGCAACGGCGCACTCACGATTCACCATCCAGTTCAGCAAAACATGCAGTTTTTCCGCCTGCG
GGCCCCAAATGCAGCAGTTGGTACGAGACGCCGTGCAATCTCGCGTCGCCTGCATAATTGCGGCTGCAGCTACAGCACACACCAAGTTTCGGTTCTGCGC
AGTTGTCCCAACCTCATTTCCAACTTCATAAGCGTCCGCAACCGTCGACTGCAATGTACCACCAACCAACAATGAGTCAATTTCTACCATTTACAGCTTC
TCACAACAGTTAAAACGCACCAAAGCAGCTTGCAACCGTGCAATCCGCTTGTGGTCCGACAGCGACAGCACTCGACCCTGCACAGTCAATTTCTCCAATG
AGTGAGGCCACCCGCACCACTATCAGCACTACAGTGCATTGTTCAGCCCTAATTGACACCTCTCCAGTGCGTTCCAGCACGTCAACGTCGTCACTGCCAC
TGGGTTTGAGTAAGGACTCAGATCTGATTCCATTCTTCACCCGGTCCAGACTTGTGATTGCCGCCTCCATCTACGCATCCACAAGGATTAACTTGCACGA
TTATAATAGATAAAGGGGAGAGTATAAATTTACTGTAGACATACGTGGAAGAGCTCACAGTCCTGTAGCACTCGCAGCAGCCGCCCCGCGCTGTCGCGAT
CGCGAGTTCCGGCCGCCATTTTTTTCGTCTTGTCAATTCAGTCACGGTACACTAATCCAGTGTGGTGCACAAAAATATACATATGGCTACAGCTGTGAAG
AAGGGACGGCTACAGTTGAAGCAGCAAAGGATACAGTTGAAAGACACTGGTTGAGCCATTAGCACATGCATTTTCTCATTCGATCGAGATGGTACCAACT
CCATTTATACATACAGAGCTAGAGCTGGTGGCTTCCTATCACTCGGAAGGTCGTGGTCCTGTCCTGTCGACTGAGGCTTTACAGCGTCAGGGTGTTGGGG
TCGTCTTGGCGGACTTTGTCCACGTCATAGTACGTCGCACTGTCGTCGGAGTGAGCGCTCAGGAACGACTGGTTCGAGGACTGGTTCGAGGAAGCTGATC
TCCTGCGGTGCGACGGGTAGTACATGCCGTCGTTCGTGCTGGTGGTGCTCACTTGGCTCTGGGCGTTGAAGTCCACGCGAGATGTAGCGAAGTTGACCCT
CGACTGGTAGCCATACGAATCCACCGAGTCGCGCATCGAGAACGCAGACGAGGTCACACCGAGAGGACCGATCTCGTAGCTCTGGCCTTCTACGTCGTTG
GTTTCACTTCCTTCCTCCTCAACGCTAACCACGGTCTTAGATCGACTCTTGAACCAGCCGCTGCTGTCACCATCAAAGCTGTTGTCAGAGTCGTTCGAGA
AGATCGACATCTTGGCCTGAGGACTGCTACCGTAGCCTTTGCTTTTGCTTTGGTTGCTAGGAGCAGCAGCACCCATTGCGGCGGAGAACGTATTGTCTTG
CTTCACAGCCTGTGTCACGTCCGGACTGGTAGCAGCAGATGACACAACCGAGTCCGAGAAGTTCACGTAGGACTGCTCCATAGGAGCATACGAACTGGCC
GAGGAAGCTGCCGGGGTAAAGCGCTGACCCATAGTCGATGCTCCAGGAGCAAACTGCCGGCGTGCCATTGAGGGTGCTGGCTGCGCGGCTACGACGTCTC
CGTCAACATCCACGTCGTCGATATCCACATCCTTGTGCAGATCGTCCAAATTGAAGCTGTGCTTCCTTCGCGAAGACGAACTACTGATACCAGAGTCCGT
AGCGGAGAAAGTGCTGACATAAGCGTCGAGGGGCACAGTCGATGGACGTGAGCCGAGACCAGAACCTGACATCCCCGTTGCGATCGAAGCACCTCCTCTT
GAAGACTGGCCTCGCGATGACGGCGGGCCTCTCGATGACGATAGACCTCCGGCCACGTGTTGGCCCCTCGACGAGTTCTGTCCTCGTGACGAATTCTGTC
CTCTTGAAGACTGTCCTCTCGACGATTTAGGTGACGTTGAGTGTCCCGCTTCATCGTCCGTATTCTTCGTACCAAGGTACGCTGACAGCACATCGTACGT
CGGAATTGGTGCCTCGGGGATGGGAGCAGCAGCAGGGGCAAGCGCTGCATTGCTGATCGCAAAATCATCAGCGCTTTGCGTCGAGTCTCCAAACGAGTAC
TGTTGGTTACGAGAAACGGGTGGGCGAATCTTGCCTTTAGAGCGACTGAAAACCGGAGCAGGCTCCGGGGCCGGCTCCAGCATAGGCACGTGCTCTGAAT
GACCACTGCGAGAACTCTGTGTAGTACTGTAGCCAGACATCGCGCTCGTCTGCGACTGGTACTGTTGCGGTTGATACTGTGGTTGCTGGTCAAGCTGTTG
CTGCTGCTGTTGTTGCTTATTCTCATACCAGTCCACGCCGCGGCCTGCTGGGGTAGTCTCAACTTGCTCGTAGTTGCGAGCGTTGGTGGACGTGTGGTTG
CCGAACTCGAGGTTGATGTCGGTGGCGTCCAGGCTGGAATTTTCCTTGCCATCCTTCTTGTGACGACAAGCAACGATCATCTTGTGGATGATCGTGTACG
CTTGACGCACGAATAATAGGAGGAAGATGAACATGTTCACACCGATGATGCCGTACGCCACATTGTCGCGCACAGTCTGCGGGAAGTAGTCATCTCTTGC
CACGATGAGCATGAGGCAAATGAGAACGACCTTCATGAACACGGACGTAATGCCGATGTAGTACAAGAACCGCAGCAAGTTCGGCTGACGAATTAGCAGC
AGGATCAGGTACACCATTGTGATTGCCAGGATGCACAACAGTTGGGTCGTGGCATCCCGAACAACGCCGACGATGGCGCCGGTGAGCACTGCCAGCAGAA
TACGGGGGATGAAGAAGAAGCGGTTGTCGAAGTTGTACTCGTCGTAGTAGACGCTGTACTTGCTGCTGAACGCTCGCTGGTCATGCTCGTACGTTCCGAC
GTCCTTGAGCTCGTCGGTGTTGTTGCCAACGACGATAATACCAAGTCCAAGAGCGCACAGCACAACAGCGACAAGTGCAACGATGCCGAGTGCGAAGCGC
GAGCTAGAACCGCTTGCTGAGTCGTTCGACGACCCCTCCGAGATGAAATAGCTTCCTGCCATGGCAAACATGTACTGCGCTAGCAGCAGCGCCAGCACGC
CGGCCCAAACGACCTTCCGATACCACTTGCGCGCCACGTCACCGAACGATTCGTTCTTGGCCAAGGCGCCCGTTATCAGTACGATCACCAGGTACAGAGC
GTGCATCGCCGCGACTACGATGACAAACGTCACGAGCGTGTAGAAGAAGAGGTCGTCTGCGTCCACGCCGATGAGAGCCGAATATCTCGCCGGGCCTGAC
TCTCCAGCAGCCGCGACGATGCCCGTCGAGCCTGAACCTGAGTCCGCGAGTCTTCTTGTGCCATTGGTACTGCTGCTGGAGTCGTCACTGCTCCCCTTAA
TCAGGTTAAAGTTGGTCCACGAGAGTTCCTTGGAGAACTGCAACAAGAATGTCGGCGCTCCCTCGATCCGGAGCTGGCTGATCATGCCTGCGAACTGTGC
CTGCTCCACGATGTGCGTCATCTCGTAGAAGCCTCCAGAGAAGCTCAGCGCCGCTGCAGCACTGGGCATTATCGAAGCCCAGAGCATCGAGCCCGTGCCA
ATCACAGCGGCGCCCGCCAGCGAAGTAGCAATGACGCCCGAGGCCGTGGTGCCGGCCTGCGAGTCCAGGAAGTGCCGCGTGCCCGTGGAGTTGGTGGGCC
ACTGCGTGTTACTGCCGAAAACACATCCGGAGCACGAGTTGGCCTCGACGTAGCTGGCGTTCAGGGCGCCGAGGTCCACGTCCGAGGCGAGGTGGAGCGC
CTGGCGGATCTGCTCCTCGCCCCACGGGATGGCGTACGTGTAGAAGAGCAGGCCGAGCGCGGCCAGGAAGGCGAGTGGCAGCAGCAGCGCGCAGAGCTGC
GAGATCGCCATGCAGCCGCAGCATTTGGCGGCGCAGCACAACAGCCCCATGACTACCGGTAGCTTCGGGGTGGCGGGTGGATTACCAGTATACGAGGGCG
GCGCTCGTGGTGGTGGACCTGCTGAAGCGGAACTGGCTGCCGTTGATGCGCTTGCCTCGGTGGATGCAGAGGCGAGGGGAAGAGCCTGTAGGAGACTCGC
CCAATGCACAAAAGTCGGATGGGACGCGAGGTTAGAGACCCGTGTCAAAGTGCAAGTGTTCAGCTCGAACAGCTCAATCAGCTCTCTTCAATATTGACCA
ATGGAAGCACGCGAAAACGATTCAGACCGTTTCGGTGAGTGCACTTTCGACCAATGGGAGTATGAGACAGGGGTTGTCAAAACAACCGTACATGGAGGCT
TCTAGCACGTGCATGGCACGACATTTGTTGGCGCGAAGAAGGCTTCCACTGCATGTACTACATGTAACAGAATCCTTCTTCGTCCTTTGGACAGTGTGTT
GAGCGTGCTGTTGCAGGCTCTGATAATCGAAAAGCACGATCGTTTGACGTACGTGATAGGATACATATACGGTAGCTTTCTGTGCGGACTTTTACTCGAA
ACCACTTCTCTTCTACCGAGAGCGGAGTTTGCTTTGTGTTGGTGAGTCTCCTTTGCGTAGCTTTCCTGGGCGATGTGGGGGTGAAGAATACATGTACGAA
GCACGCTGACGGCGAGAAAAAATATACCGCGCTTCGACAACGTCATGTCATGCGGCGACGATGCTTTGACTTTGATTGGTACCTATGTGGTTTACACAAT
GCGATGTTCTAAATGTACGTTTATCCATCAAACCCGTTTCTAAACTCATTCGATCGTTTCTAAAATAGACTATGGCCAGCGCGACGCACCCGTTTGAATG
GTACGGCCGTGCACCGACGCCCCTAGCGCTCGCTCCGTGCCGCCTTCTCCCGCTTATCAAAGTTGACATTGCTCTACCCGTTCTCTTCTTCCCAGCGAAG
TCAGCCTCTCGTTCCCCGCGGCTGTGGACGCGCAGTACGTGTTGCAGACGCTCGAGGTCGACGATGAGCTGCAGCCCGACAAAATCCACCGCACACTGAC
CGTCAAGGGCACAGAGCTCCACGTGTACGTATGAGGCTATTGATTCCGTCTTTGTCTGAGGTTACTTTGTGGTCTATTGGTGCTGACTTGTTTGTTGTTT
GTTGTTTGTTGTGCGGCCGTTTGGTTGGTGGTGGTGCGCTGCAGCCACTTCGAGGCCACGGAAATCCGACTGCTGCGCGCCGCCGTGTCTTCGTTCTACG
ACATGGGCGTGCTTGCCGCACGCACGCTGCTGGAGTTTAAGGAGTAACCGAGGCAAGAGGAATAAAGTACTGCGTCTGGGTTGACCAAATCCGTTTCGGC
CCATTGGGAACTGCCTCCATCATGCCCGATCCACGCATCAAGTGCTGACAGGCGTCACTGCTTGACCATGGCAGCAACGAGTTAACCTCATTTTCCGTTA
GCAACGACTTGGCGCGTTAATTTAACTGCTGGTGAGGCATCTTCAAACGGCAGGCCAGGAGTCTGGTTCGTTTCGACAGACGGTTTGGTTCGCAGCAACA
CCCCTGAGTATCTGGTAGAAGCTTCCAGCAAGTGGAAGCGCCTCTCTAGTGTGGCCACGCGAATTCACTCAACCGTGCGATAATGCATCGTATCACTGCG
AGCAATTGCTATCTGGAGCAGCGGTTGGACATTCCATTCTGCTAGTCGCGGGAGCTCGAAGACACAGAATCAAAATGTCAAGTGTAGCAGCTCGTGAAAG
TGGTTCTGGTGACGAGCATAGCGTATCAAGCGTATCAAGCGGGGGTCAATTGCTGCGGGATGGAGTCCATCTGATGGACCGTTGTCCACTACAACACAGT
GCTGGCACCTGCGACAGATGCAAGCAGAGAGGATGGATTTTACTTGTAGAGCAGGAGAGGATGGCTTGAGGTTTGCTTGCTTTTGGGATGCGAGCCGACA
CCGATTGCTCTTCGCCGTGTAGTGTGGGTCTCTGTACTTGATCACTGCTGTCCCACGCCGAGACTACTGTATAGGGGGCGGACAAATCCAAAGGCTCGCC
CCAAACGCTGCTTTGAAGCACAGCGGCGGTCAACTTCCCGACATGAAAGGACGACCGCAACTTTGCTGGGGAAAGCATGGTGGGGGCTAGTGCTCCAACG
CGATGACTTCCGTTGATTCCGTTGGTCTCGAGGCTCGGTGACGTTAAGCGCGTAGTGAGCGCTGGTTTCGCGGTTTTTAGCCGGTTTCCGGTCTCGTAAC
GGGGCCAACAACTCCATGCAGCATTTACGCTTCATTTCTCCGGACGCAGAACTATTCCTTCCGGTTGCTCTGGCCTCACAGCCAAGTGAACCCCATGGGA
AGCACCACACAGCTCCATCTCACAACTCAGGTATGGGTGCAGTTGAGACGGAGATTGCCAACTTGGAAGCGATCGCCGTTACCAGGGGAAAGCAAAAGCA
GTCGGCAACGCAGACAAATGTCCTCGTGGTAGGAAGGGGGGGGGGGCTGCGTGGCAATCGTCCTCGGCCGCTGCCGCTGGGTGTCGTGCACATGCGGACG
GGGCTGGAGACGATTATCATCTTTAACCCTTTCACTCGCAGCGCGCCACGTTGTTCACTGAACCTTACGAGATTCGCAAGGTGTATGTACATACAACGCT
GGGTGTCTGGATCCCAGCGGTGGTTGGAATGTGACCTGCCACATGGGACTTCCTGAAACAACCGAAGCCATCGCTAATACCTGTACCCAACAGGCGCCCG
CAGCAAAACCATGTCGAGACGACCAAGCAGCTGCCGTTTTTCTGAAGCCGTTGTGTGTAACGTGCAAGTTGTCGGCAACTTGTGTCACCGAGACACGGGC
ATAGCCAGCCGTCGATGTCCAGCAGGCGGGTTTCTGGGCTGTGCCCAACGTCCCTCTCCTGCTTATCCTAGCGAGTTGAGGTCAGCGTGGCGGCAGTCTT
TCATCACTCGCCAATCCGCCCGCTTCCAGAGATTCACCGTCCACCTCGGGCTGAAGCATGCCGTCCCTCTTCGTTGACGAGCTGGCTGTTGACACCCGAG
AGCTCGTGGAGCGGCACGTGGCCGAGTCGTTCGCGAGCCACCGCCCCGTGTCCTTCGACGACGCGTTGTCCCGCTCGCATCACACGTTGCGCGGTCGCAA
CTCCATGCCGGCAGTGCTGCGACTGTCGTCGGACTTGGGCTCCAGCCGCCTCTCGAGCTTCGGCAACATCCCCGGCCACGAGGTCATCGAGACGTCGGTC
CGCTTCGTGGGCGTCACCCGAGTGTCCACCCATTGCGAGTTCCGGCTACACGTGGACACTGGCAAGGAGAACTTCGTGCTGCAGAAGCGCTACTCGCAGT
TCCGCGACCTGCGCCAGCAGTTGCTGCTGGACGGCAAGTCTGCTGCAGCGGGTGAGAAGGGACGCAGCGGCCAGTGCCGCAGTGGAGCGTGTCTGCAGCT
CGCGCAGCAACTCGCCTTGCTCAAGTTTCCTCGACGCAAGATGAAGTTCAAGCTGCACCGGGACGACGACGTCCGCATTGCAAGAGAACGCCAGGCTCAA
CTGCAAAACTTCGTCGAGATGGTGCTGGCAGTGTACCGCATGGCGCCCAAGCGGCAGGTGCGTTGCTGCGTCAACTCGCAGTGTCGAGTGCTCAAGGCTA
TTCGATCCTTTCTAGACATTAAGGATTTGGGCGAGGACCTGGTTCCGGACTGGAAGTCGGTCAGCAATGGCAGTAGCACCGGTGGTGACGTGCCGATTCT
GGACACGCCGCCGTCGACAGGGGGGACCAACCCGTCACCAGTTAGCACGTCGTCCAGCGATGCTGCTGGCTCAAACGGCTCGCCGATCCCCGCGAGGACG
TCGGCCATGTGCTTGGAGGAACTGTACACGATCACAGAAGACACCGAGCACGCCTTCGTCTAGACGATGTAGCACGACATAAGGACGGATGCAGTCCTAG
CGTCGTGGACGCGACAACCAACCAACTCACCAGTCGCCATCTGTAGTAACTTATTTGCTTCGATTGTAGCACCCGCTCCATCGGTAATTCAAGAAGATGT
AGCAATGGAATCCCATTAATTTACCTTTGCACGTGAACACCTTTGTTCGAGTTTAGTGTTCCACACCTTTAGCCTTGAGCAATTCTACGATCACTGTTGA
GACTTTGTCCTCGTCGTTGCTCAGCCCGCCCATGATCTGCGAGGTCTTGCCCCACTGGACGTTGCTCACGAGAGCCTACAACCAGCAACAGCAGGTGTGT
CCGTTAGCTCAGTTGTGCTTCCTGTATCCGTTAATCGAAAGCGTCCAACCAGTTGATCAGTTACCTGCTCATGTTTGTTGTCAGTGGTGCCCCGGCCACT
CAGACTCGTGTTGTCGCTGTCCCCGGCGCGCTGTCGCGCCCACTTCATCAAGTTGTGATTTCATGGACATACCAGCACCCGATAATGTAAGACATGCCAA
ACTCCTCATCTGAAAAGCATGAAGTACGTACGCTTCGCCAGCTACTATCGTTTCCACGCGAACGACGCGGAGAGGGTTTTGGTTTGTCGATTATTGGCTT
TTGCGCTCGTCGTAGTTGGCCACAGGAGACGCCCGGAACGCCTCGCTCGGTTTGAGCTCCTCTGCCAGACGTCGGTGATAATGGCAGCTTTGGCAGACAG
AAGTTCGGCTCGCGTACTGATCGATAGCAACCAAGATCTGGTCGTGGTCCCATGGTTGGAATGTGCTCTTCCTCGTGTCTAGTGAGAACAGTGTCCACCA
ACTCTTGTTTGTACTGGTTCCACCTCGCCTCCCTCCGCAAGTCTCGCGTGACGCTGGAAGTATCAGCACGCGCTGAAAGACCAATGACTTCCTGGCGCAG
CATTTGCTCGGTGGTCGCGTCCTTCAGCACAATTTGTCGGAAATCCACGCGGTCGACACGATACAAAGTGGCCGTCGGTGAGGAAACCAAGACCGAAAAC
ACCGCGTTCGTCACACCAAGGGTAGCCTCGTAAAAGCCAAAGTAGTGCTGACTTCACAAAACGCAGTGCGAGGGTCAGTATGTTAGATAAGCTTCGCGTC
GAGAAGCGGTATTACTACCTGCAGACGGTCGATATTTCAACAATGCATGGCTGCTTGCGGCTGTCGTGCTTCTTCTGGTCGAAGGCCGAGTAGCGTTTGA
CCAGCCTGCACTCACCATGCTTGATGAAATAGAAGTTATCTTCGGACGAGAACCAGCGGAGTTCAGATCAAAGGCAACAACAGAAATGAGCATCACGTTT
ACTTACTTGCAGGTTCGCCTTCCACAACAATGACATCGTTGTATGTGTGCTGTATCTTCTCCATTCGGTCACACAGCTTCAAGATGCCTTCGTCTTCCCA
ATGATCCAGGCAGGCCACACCTGCTAAGAATGTCATTTTCTCGCTGGCAGCAAAGACGACAATTTTGCAAGTTAGCTAGTCCACGTGATTGAAAGTTGCG
TAAAAGCTCGTACCGGAGGTCACGCGACAGATTGCACGCGCGTAGTGCCATGAACGTGTCACGATCAATCTGCATGAGCAATGTGGTTTCCGTGGCCACA
ACCGAAGCGGTACGCTGTTGCTCTTCAAGGAGCAGGCCAACGTCGCCGAAGACTTCCAGGGGCTTCATCGTGCGCACAATGTACGTAGCATCATGTGACC
GATCGATCTTTCCGCCTGGGTTCAGGAAGCTGGAGTGCACGCGGGCTCGATTCATGATCTCCTCGAACTCGTTCAGCGTTGGGGCTGCCATTCGCGAAAA
GTCCATGACGACGCTCATCGTTCCATACATGATGCAGTAGAACGCATCTGCACGATCACCGATTCTGAAAAGCGCATCTCCGTCCTCAAGCTCGATGCCT
TTGGCGGCCTTCAAGAACCGTAGTCGGTCTCTCGGTGGCTGCTCGCGAAAGTACTTGACGCGTTGAACTGTACAGCACAACAGCACAAAGTCAATGCAAA
TAATGACAAGACGTCGGCCGTGAAATTATCTGTAGATACACCGCTTGTAACATACTGTATTGATCGAGGAACTCGTAGTCGGCCTTGCATCTCGCCACTT
CGGACAGCAGAAGAATTCGCCTCAAGTTGGCTCGCACCTCCGGAAGTTCGTGGTTTAGCTGCTCCTGCCAGCTCGCCCTCTTCGACAACCTAGCAATGGT
CACATCGTGTCACAACATACTACCAATATATGGTACTATCGGCTCTCTGAATGCCAGGCATACGCACATGCTGCGCGGCTTGGCGAGTGGACGACCAAGA
TGTTGAAGGTAGTAGCCATTTAAAATTATAAATGGCTACATGTACCTAATATAGGCGTCCTATGCTAGGTTGTCTTATGTCATCCACACTACTTCTGAAT
CTCTTTTTGTCGACCACTTCACTCCCACACAAAGTCGAAAGGTGAGCACGACGTCACATGGACGCATCTGCTGCCTGTTCACGCTTGCGGATGCGCTCCC
CCAGCGCCGTATCGCGCGATACAACAACTTCACCACGTATTTATCCCTCTCACATACCTGCTGGTGTCATTTTCACGCAGATTCTCGCCGTCTATCGCTA
TTAAACTCCCGCCTAACGAACACCATGGACCCCGAGACCAAGAAAAAGTGTTTGGACGTCGTGGAGCACTTTATCAAGCTCGATAGCTGCGGTGTGTTGC
CATTTCTATTGAATTAGGCTTTTCCGGACTGGTAGCAATAGACTCACGCTTGTTTCTGTGGCTCCAGAGCCCTTCCGCGAGCGTGTCAACTGGGAGGAAT
GGGGTCTGTACGACTACCTGCAAGTGGTCAAGGAGCCCATGGACCTGGGTACCATCCGCAGCAAACTGAGCAAGAACGAGTACAAGAAACCGGCCGAGTT
TGCGCGCGATATGCGCCTCGTCTGGCACAACTGCAAGCTCTACAACCAGGACGGCTCGGACCTCTATCTGCTGGCCGATGAACTGACCAAAAAGTTCGAG
GACCGGGTCAAGACCATGAAGCTGGACGTGGGACCGGTCCCCAAAGCGGACAAGAGCATCCCGTACGGTACATTGATGTAGCTTTGATGTTTTAGTTGGT
GAGTTTTAACGTGGTATGTGCTGTTGAGTAGAGCCCCGAGTCTGGAGGAAAAGATTCACTTCAGCCAGAACATCTACAAGATCCCGAGCAAGGATTTGAA
TGCAATTATCGAGCTGCTGCAGGAGCAATGCCCCAAGGCGCTGGACAAGAGCTCGCCCGATGAGCTGGACATTGTCGTCGACCACATCGACAACAAGACG
TTCCGCGACTTGGAGAAGTTCGTTCTGGAGAAGGTTCCTGAGGGCAGTCGCGAGCCGATCTCCACGCCCAAGTCGTCGAAGAAGTCTCGACGGCCACCGA
GCAAGAAGACGAAAACCGATCCGTGATCGAAGATGAATGCGTTTTGAGCGTGCCTAATTTGCCTTGACTTGTGTTTCATGCTATGCCACAGCCTTTCTGG
ATAAAGAGAGAAATGGCGCGTGTATTTAACCTCATCCAGGCACGCAGTGAAAATCGACCGTCTACTTGGACGGTATGACGGCTTATCAGGGTATTTAGTC
ATCTTTTAATCCCTTTACGCTTCTTCCCTGAGTATTGCTGCTCTCATTGCGTTATCTACTTCTTCTTTCGAAGCATAGTTGCAAGCCGTGTTTGCCGTTG
GAATGTGGCCTCGAAGCTCTTTCTCTTCTGCTTTTGTACGGGCTCGTCAGGCTCGTGTCGAACTACGGCAGCTGCTGGTCTACCGCCGAGCCTGGTGAAG
TCTAGTGGTGGCACAACGATATTCTGTGCTGGTGATGCTTCATCAGAGTCATCTCTTGGCAACCCAAGCTGGACGGGAATTGCTGCTGAAAGGCGAGCCC
CTGCCTTGGCTCGAGTGGATTGCCACTGAGGTGGTATGAACTTAGGTCCATCAGGCTTCAGTGTTGCCCCAGTGCCGTGTGAGGCACTTGGGAGTGGAGC
CACTGGCTGCAGTTTCGGCAGCGGGAGTTGAAACTTTGACGGACGGCGCATCGTTTTCCTCTCGTTCGTCGTGAAATCCCGCGCTGTGTGTTGACGACTC
GATTCGGGCTGGTATTGGGACGAGCGTTTGTACTCGAGCAGTTCCTCCTTGTGGAGCTCCATCAGCTCTCTAACCACCAGTTGAGAAGGTTGTGAAAGGT
AATATCGCGATCTCAAGAGTACGCGACGACCAGAGAAATGCATATTACCTGAGTGAAGGCTCATTGCTGTTGGCGGTGTTCCAGTTGGTGCCGTGAATCT
TCTTGCCGGCTTTCATGAGCCTGGTCCATTCCTGCACAGCAAAAAGGTCATGACGCTGGACGATGGAGGCCAAAAGCATGCTCAGCCTTACCTCCTCGTC
GTGCCGACTGGTTTCCACTCTGGACGTCACGATTTCTTCGAGTTCGTCATGATATCGCAACTGATCCTCTCGAGCAGCGAGCTGCTCTTTAAGCTTGCCG
ATATATCGTCGAAGATCCTCCTTACGTCTGCCAAGCTGCTCAAGCACGCCTCTGCTGGACTGTTGAAGTTGCAGTGGCGGGTGATATTCTACATGGAGTT
CACGGCAACACTCTCCTGTTACATGGAGCGAGGTGGTACAAAGTGTTCATTTCTGCGTACGCGTTCGTCGCTTGCGTTTTTGCATCTGCTGCTGGAACAA
GCCCAGGACGAGCAACAGTAGCAGCACGCAGCCGATGATCAAGCCAGGCGTATCGATCTTCGAGCCTGATGTGCCTCGAATTTGCGGCATTTCGCTACTT
CAGCGCAGCAAGGACATTGACAATGTGTCCTGCATGATCAAGCCGTATTTTTAGGCAAACCTCCGCGATTTCTTATGACACGAAGTGCATTTATTTCGAC
TGGGGCTGAATTGGCGTCCTAAACTGTACAATAAGATAAATAGGAGCACGCAACGCAGCTCACACGTCCGCGACGAACACGTCTTCATCCACAACGAAGG
CCGACGCGTCGAAGCTCGGAGCCGGCTGGTCAGATGACGTCGGTGTGAGCCAGTAGTCACTGAAGTCCAGGTTGTCCCAAGTTTCTCCCACGTCCACGGG
GGATGTCTTGCCCTCTGGCAACGCGGCCAGCGCCTCAAGTCCCGTGACATCGAGGCATTTACTAGCGTCTCCCTGTCCGTCCTGAAGGATGCGATCCAGC
ACCTCCTCGTCCACAGCATCAGGCAGTCGCTGCAGCTCCAACAGCTGTGCGTCCTTGGCCTGGAATCCGTCGAAATGGCCGCCGTCCAGCAGACCTAGAT
CCTGCAAGAACCAGCCGGTGGGCCCTGAGCTTGCACTGGAGGCCTGCTCGGCCTGCTGCCTGGCACGTGCCTCCTCCTTCATGGCCAAGTGGGCGCTGAG
CGGGGCGCGTCGCGCGCGCTGACGCGTCTTCTTGCGCAGACGCTTGCCGGCAGGCTCATGGTCCGCGGAGGCCTGCGCTCTGGTCTTGCGCTTGAGCTCG
AGGCGGCGCTGGTTCTTGTTGGCCTTCTGCCGGTGCAGGTCGCATAGGTTGTGGCGCTCGCCGTTGCGCTTGAGCGCGCGCGGGTTCCAGCACTTCTTGC
TCGGGTAGCGGCACATGACCTCGGCGTCGTGCGCGGGCGAAGGCGCGGGCGAGGGCGAGGGCGTTGGGGGCTTAGGAGAGGGAGAAGCTGCGCCGGGGCG
GGTGGCCATCATTTCTGGAGAGCAAAAGGACGAATGATCTCTCGCTGGCCACGCACCTGAGGCTGCCGGAAGATCCCAACTGCTCCAAATCGGATATGAT
GGCTACGCGAGCCATTTGGGTGAACCAGATGTCGGTGCAGAGACTCAACCCATAGTGAGCGTCAATGCGCGTGGATTTTTGCCGAAAATCCGCGGACAAT
TCAAGTGAAGTGACATCGGTGCCACCTTCCTGCACGCCCGGTGCGCCATTGACTGCCGCGGCAGCTCCGAGCGGTCGAATACGTTTTCTGCCCTGCTGAC
TGCAGCGGGAAGTGGATTCAGCAGGTTGCTTTGCAGGTTATCAGGCCATGCGTATTTGTGCCAGTTGGGACAGTGCCGGCGGTGCGGTGATCAACTTCGC
CTGCGCCGTCGGGTAATCCCTCGACTCGGAATCCACGGCGGAATTGTCGCTGCAGTTTGCGGTTTGCGCAGATCAACAACAATCAGAAACTCTGGACTCT
TGTTCAGAAACCGAGAGATTTTCGCCCTGCAGTTCTCTTGTGTTTTCGCTGCTCGTATCTTCGTTCTCTTCCACGTGGAGAAGGTGTTTGTGTCCATTCA
CTTTAGGTTTGCTGTAACTTAAGGAAATTCTTACTTTGTGGCACTGCATTCTGGCGGCTTAAATGTTGGCACGGGTGACGAGTGACGGTGCTCGCCGGAC
GTCCGGCTGCCACGAGCTCTGCAGCGTCGCGGAGCTCATGAGCCCTTCTCCCGATCGAGCCACAGCAGTGGCAATAGGTGGCAGCAGCAGAGTCGGAGCT
GCAGCAGCGGTCGATTCCGTCGTCGTCGGGCTGTGCTGCATCCACCCTCGCGCCTCCAAAGACGGCTCCATTTTGGCCAGAGCGGCGACTCGAAGCATAG
CACGAGGGCTCCTCGGGTAGGACTCGTCCATCCATGTAGAACTCGATTCACGCCATGTGTCCATTTCGTTGCTGTATGACGGGAGCGTATTACCCATGGC
CACGAGTCCTGCTGCTCGCTGCAGGTCTACAAGTGACGGGGTGGCTCGTCGAATGTACTGCGTTGTAAGAGGCACCGCGCCCAGTTCCTGCTCCAGTTTC
ATGGTGATCGAGGCACGCATGCGCATGCGACGCTCCAGGTCGAAGCCGCTTTGCAGCGGCAGGTGGTTGGGCAACCCGAGCACGGCCTGGCCGGCCTTGC
GCTTCTTGTCGAGGCGGCGCTGGTTGCTGTTGGCCTTTTGCCGGTGCATCTCACACAGGTTGTGGCGCTCGCCGTTGCGCTTGATGGCGCGCAGGTTCCA
GCAGCGTTTGCTGGCGTAGCGGCACTTGAGCGAGCTGAACTCGTCGTCGGTGGTCTGCATGGACATGGCAATTTTTCGACTGCGGTGGGAGGACGGATGT
GTCAAGGCGTGGCAAATTCAAGAGTGGTTGGTACCAGCGTCTTCAAGGTGCGAAAAACTCAGGAACGTCGACTTTGTGAGAGCGCCGGCATTTTTCGGAG
CTTTTCAAAGACGTAACTGCAAAGGAGCTGATTTGCGTTCGGAGCGAGCAGCCTCCGCGGCTCCGGACGCACCGAGCGATCTCGCTTCACAAGCAGTCGC
TGTCAAATCGTCCCATGGGGGGCATCTGCGTTTGCAGCGATCGCGGCGATCAACAACTCGGTCTCCGATCAGCATGAGATACCTTTGCCACGGTTCCTGC
GCGGCCTGATTTCCCGAATCAGTTTCGGCGGCTCAAGCAATTGGTACTGCACTTGCGAGCAACCGAGCAACGTTAGCGGGCCGTGCCAGCAAGAGCGAGA
CGCCCCGGAACTCGACTCCCGCCAGGAAACGCTGCGCCGCTGGCGAACGGGCGTTTGCTGAATAAGCCCCATCTGATGTCGTCGGCTGAAGTTGCAGCTC
GAGCAAGCTGGCAGGAGAAAACTATCTCGGTGCCTGACCGAATCTGACTCAAATCAGTGGGTTGCCACGAACATCGCGTGAGGCATCTTCCCCGTGCTCT
GTGTGCCACGCAACACTCTCGGTGTCTATACTGGCGCCAGCATTGTCTTTCCTCTCTAGTCGGGACTACCGCACGGTACACGCTGACTCACACTTGCGCC
GCACGTTGCGGTACACTTGCGAACCTTGAAGTGTTGACCATCTTGTCGACCTGCTACAGCAGGAAGGCGAATTGAGCCGGAAATGCCAACGCGTCAACAA
CGAGAACGCGAATAGAGGCCAGATAATCGCTTGTCGTGTTGACTTAGCGCACGCTCGGGCTGGCGAGCATGTAGCGTTCGACTACATTGCACTGTGGTCG
GAGTTGCAAGAGGAAGCCGGCGGCAATGCATTGGATGTGATGTCTCCTCG