Description :
From Genome Similarity Track
Location :
Scaffold_24:211520- 213229
Transcript NameFunction/comments
g4805.t1POM63317.1 hypothetical protein PHPALM_27379 [Phytophthora palmivora var. palmivora

Sequence
1709 bases(100 bases per row)
AGTCGGCAACAAGAAGCATGGCCGGCGTCTGGACGACGTTGACGGTGATGTCCATCCAGGCGTAGAAGATGATCGTGAATACCGACGTCCACGTACGGTC
GGTCTCTCCGTTGGTTCCGTCACCGTGGTCACCCAGGGCTTCACCAATTTCGCTCGTGTAGCCCATGGCAATCCAGCAGACGACACTGAGGACACCAGCG
GTGATGAGGTACGGGCGACGACGTCCGAGACGGGAGGTGGTGCGGTCGCTGAAGACTCCGATGCTGGGTCCGACAATGACGCCGACGATGGGGCCGATGA
ACTGCGTGAGCTGGACAGCGGAGTTGGGCAGCATCGTCGACAGGTACGGGCCCAGAGCAGCCCATTGAGCCGACCAGGCCATCTGAATGGCCATACGCGG
CATCGACACGGCGAGCAACAGCCAGATTGACGGGTGCGGCAGCGGTTCCTTGCCCGTGTCAGCTACGGAGCCAGGCTTGGGCGACGCGTGCAAGTCGTAA
CCGGGGGTTCCGGCCTCGATGTCCTTCATGGTGTTGTACTAGCAGTCGTTGAAAAGCTTAGACGATTGAAGGAGGAGGCGGTTGCTGTGGAAAGCAAATT
GAAGAATGAGAAGTGATGTCCAGCTTCAGACGCGCCGGCGGTGTTGCAGCGGCAACCGAGCGCAAGACACTCGCTTGCAAAAGCCAGGCGACGTTGACAG
AGCGGAGACAGTGGAGACCTTGATGTTGTCCAGCTGGGGAGTAGATTTATGTGCAACGTCGAATAGGTTCTCTGCAGATGGTGTCTGCGGTGCTGGCGGA
CGAGCGTCGCGACGCAGACGCTTACTGACGCACTTTTGGGGAACTAAATGTTCGGCTAATTCAAAAACGGCGACCAGCGGCTTCGACTTGGAGCTTTCAA
GCTGCGACTCGCGTTTGCTGCTTGGGAGCTTTAACTTCAGCTTTGCGAGAGGAGCTGAGGGGGGCTCCCATTTCTGAACCATGTGGGCTTCTGCTTGGGC
TCCGCCGCGAAAGCTCAGCTTTCTCATTAGATAGTTCAACCACGGCAGATTAGGCTCGGGTTTCCAGCTGTGCCGACGTAGGGCTCCTATTTCCCAGCCC
AAATCCACCGATTGTAACGCAGACAATCGCCAGCAGGCATCTTTTATTTTGCAGGCAATCACGTTTGCGTGGAAGCGCTTTCGGCGCTTCAACTTGAAGT
ACTCGGCCGCGTTCAAGCAAATCCGGCGGGCAAGCGAGACTGAACTATTTGATGTCGTTGTAGACCTAGGCGGAGGTCTACTCAAATCAGTCATGCTCTC
CGGCGGTCTTGCCTGCGTGCAACTGCAGTGAGATGCCTACCCACCCGAGTCTCCGGCGGTGCTGAATTTGCCGGGCAGCGTGTTCGTCGGGCAGCAGCGG
CATTTGTGTGAACTCGTTCGTCGTTGCTGGCGCTATTAAGCAGGATAGGCGCGGTGAAAGTCCTTCCTGCGGTCACAACGTTCCGCTGGATTTAACATCT
TCGCAGGAACCATGATGGCTGATGAACAGCGAGCAGCGCACTGCACCGGCGACAACGCAGGTTGAAGTGATCTGTTCCAGCCTCGCCGTTGATGCATCAA
CGAATGGATACCCAATAAGGTGGTCTCACTCAACGGCACGGCACGTCTTCTTCTTCAGCGCTGTTTTGTGCATATTGTGCAGCGCGTTGAAGTCTCAGCG
CTGCCGAGT