Description :
From Genome Similarity Track
Location :
scaffold_349:21147- 22802
Transcript NameFunction/comments
Pl_105792conserved hypothetical protein

Sequence
1655 bases(100 bases per row)
TACACCTCCGAGCCGCTTACGTCGTTCTCATGGCAGCATGTGGATTCGCCATCAAGAATGCAGCGCGCGACGAATATGGGCAAGGGCAGCAATGCACAGA
AACACCAGCTTGCAGCAGCAGCTTTCCCAAACCGACTGTTGACTGCATCAATCACGGGTGAGCTGGGAGACATTTCTGTACACGATGCAATGCCACTTTC
GCTCTCATCTCATGGAGCAGTCACATTCGGCTGTGGAAGACTATTGTTTGGTGGGTCTGTCAGTGGACCTGGATTGGGAACATCTGCCGTGGCTCGATTG
GCACTGGAGGAAGAAATTACGTCAGGCTCTCGTATGGAAGAGGATATATCAAATGAAATGTACAAGCTCGCTAAACAAGGATACTCCGTTGGACTGTCAA
AAAACCTGAAGTTATTCAACGAGTCTACTCAACGCGGCCGGCAGCTACGCAATTTGTGGCTATGGGTTGACCAAGTTGAGGCTCTTCGCCGAATCCGAGC
TTCACGTGTGGAACAATCACGATCTACGACTAATGGGCTCGGGAACAGCGCTGTAAATGCTGCAATGGCTGGTCCACTGCGCGGGTGGCCAGTTGATCCA
AATACTCTTGTTATCGCTGGTGTGAAGAATTTGTTGACAACTTCTGGGGAACCCTCGGCAACAGGAAAATCGGGTTCTTCTGGATCAACTGCCACTGTTC
AGGAAGATTACAGAGAGGAAGAGCCTGCTGTCGTGTCTGTGGCAAAGACTGATCAAATCCTTGGATGTCAGTACTTTGAAGGACCTGGGCGGCGATTGGG
TTTGCTAGCATGCAACTGGGACCCCGACAACGGTCAGGGAGCGTCACGTTCGTCGTCAGCAGGTGTAGGTGGACCAGGACTGGACAGTGCTGCGGGGAGA
AACATGCATCGGAGTAGTTCAAGTATATGGAACCCCCAGAAGCAATACGATGATAACGCGCATTTTGCCAACCGCTCGTGGAATGAAAATGGCAGACACG
AGCTACAGAACATCCTGAACCGATGCGAGTTGGAAGGTAACTATGCTCGAGCGGCGGCACTGGCAGTTTTTCATGGAGACTTGAACGCAGCTGTGGCGCT
TCTTCAGAAGGGAGCAACGTGGCTTACTCAAATGCAGCACTTGAATGTTGGGGTCTCGTCGCCGTATTCGCCAGACTTGCTGCAGCTCATTGCAATGTCT
GTTGCGGGCTACTCATCGTCAGTTGCTACTGCAGGTGGGTTGTCTCTATGGTCAAACATGACTCAGCAACTTTTGAAGCGGAGTGAGATCATGTCACAAG
CTAACCCTCGCTACTTTCACGCGATGCTTTCGTTCTTGTGTGTCGCGAGCTCATCTTCATCATCTAACTCAACGAACGCTATGCGGACTAGCCAGCAACC
CCAACGGCGTGGGAATAGCCGAAGGCAGTGGGGAAGTGTGGATGGACTTGCAGTTTTTGGTGGAGCTAGACCTGCCAGTGCAGGTGCATATTCGGCAATT
CTCAACGATATTACACTACCCTTAAGTGATCGACTTGCTTTCGCTTGTCGGTATCTTCAAGCTGATGAGTTGCTCGCGTTTGTCGCTCAACACGAAGAGG
AGAGCGAACAGTTCGGACGCCTGGAAGGATTAATTGTGACTGGAATCAACACTGA