Description :
From Genome Similarity Track
Location :
Scaffold_103:211346- 212355
Transcript NameFunction/comments
Phyci_12768Hypothetical protein

Sequence
1009 bases(100 bases per row)
GGAGATCTCTCGGTGCAGTGTACGCAACTTGGTTGCACTACGAAGCAAAAAGGATGGACCCAGTGATACACTTTGACTGGGGCGGCCAACTGCTTACCTT
TCACCCTTTCATGAACCGGGTTCACATGTCAACAATTTCAACATAGAGTAAGCACGTGAAGAATCACTTTTCCCCTTGGCTCTATTACCAGCCTGCTATT
TATTAATTATACTCTTATTAATAGCGGTTAGCGCTTCATGAGCATTTTGTCTTAACCATAACGTCGTATTTTACATTTGTCTTATAATGTCTAACATGCA
TGGCGTTTAGCTGAGGAGCAGATTGGGTGACATCGTCAGATGCTCCCACCACACAGAGAACTGCGCCCACTGGATCATCAAGTACTCGGCATGCAGTTGC
GACTGGCACGCCGCCCAGCGGTCACACACGATCTCAATCGAGTTTCCATCCACCTCAGTCAAAGCCACGTGAATGCCTCCTTCCGTAGCCCACTCGACCC
TGTCTTGAGAACCTTCAGCGTTGCGGCTTCGCCTGTTAGCGTCCGAGTCTGTGATTGCTACACTTGCGGTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNN