Description :
From Genome Similarity Track
Location :
Scaffold_1453:2113- 6748
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1453-fgenesh-gene-0.2Inositol polyphosphate multikinase
Pytul_var.sporangiiferummaker-pug3_contig_1453-snap-gene-0.4DTDP-6-deoxy-L-mannose-dehydrogenase
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1453-abinit-gene-0.8GJ22975, partial

Sequence
4635 bases(100 bases per row)
TGAAGCTGCGTCAAGAGCGCCTGGAAGCACTGAATGAGCGTCGTGATGCCCGTGCGCACACCTTCGTCCAGCTGCGGCGCGTCCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGTGCAAAGTCGATCAGACGGATGTCCGCTGCCAGCGCGGTCGTGAGCGCCCCTTCCTCATCATCGTCAGCGTTTGCCGAAATCT
CGCCGTTGTACAGGAACAGGAGCGAACTCGCGATGAACTCCAGCTCCTGCTGCGTGCCAAACCACGCCTTAAACTCCTCCAGGCGTCTAATAAACTGCAC
AAACGACACAAAAAAGCAACGTACCAACGCTCAATACCAGCGCATGTTTGCAGTGGGGTTGGCTAAACGTACCGCTTGTAGCAGGAGAATGTTGACTTTG
GCGCTGCCAAAAGTGGCAAAGTAATTGCCGAAAGCGGCCACGAGGTCGTCCTTGGAGCCCACGTTGCGCCCAAAGTGCTTGTCGAACTGCACGTACGCGC
GGCGTTTGGGGTCGAACGCCTTGATGCCCTGGATGCGGAAGCCCACGATCTCCTGGAGCGGGAATTTCTGCTTCTCGTACGCGATTTTCTCGGGCGACGC
GTCGTGTTCGTACGACCGNNNNNNNNNNNNNNNNNNNCCCACTTTGACGTCCATGATGCACGGCCACGTCCGGTCGAACGTGAGGTCCTCCATCACCAGA
TGCTCTGTGGAAACGCACACATACAACCGCCATTATTGCGAGTTGCTTGGAAGAACGAAATGCACAATAGAGAGATACGTACTTGCATCGAGGTTGTCGC
TGTTGACAGCGGCTACGTCGCCAATATGCGCCTCCTGGGTCGTGGGGTTCACGACCACCATGCCGTGGTACTCTGGGAGCAGCGGCTGTAGTTGCTTGTA
TACTGGATCCTCGTTCTGTGTGCGGAAGACGCGCTCGTAGAACGCGTGCTCGCGCTCGCCGCGCTGCTTGCTCTGAAAGGGCTTGAGGATCTTGCCGCCA
AACGACTTCAAGCCTGCAGCATACACGCACAGTGAGATAGCACTCCATAGAGGGAAGAAGAGCAGGAGCAGGACGTACTCGTCTTAGTCGTCGCATGGCC
GCCCACCTGGTGCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGCGGCGTCTTCGTCGCCCAT
TTTCACAATGTTGGACGACTGGCAGTGCACCTTGAACAATACGACGGAATCAGACTTTATATGAAGTGTATTATGGTCAATGGATTCAGATTCATTCTGG
AATCATATTCGTAGTCAGATCCATTTTGGAGGAAAATGGCACCCACGCGCGTGTTGCTGTTAGGCGGCAGCAGCTATGTGGCGCAGTTCATCGTCGAGCG
GTGCCTCAAGCAGCAGCATGGAGACAATGCGCAAGCGTACGTGGTCGCATGCACGCTACGCAGTAGTGCGTCGTTGTTACCTTCGTGCTTCACGCCTGCT
CCTTCAAGGGAGGACAACGCTGAGCAGCAGGTGCAAGTGTACTGGGATGTGGATCTGATGACCATGACGGGAGTACGAGAGTGCATTCGAGATTTCCGTC
CAGATGTGGTCATCAACTGCGCAGGTACGTACATGAGCAGCATGCCGCTATAGTGAGCATGCGGCTCTATGTGTGACTCGGGGAGCTTGATCAAGATCTA
TGATTGTGTTGTATGTATGAACAGCGGTGGCGTCGCCTGCGTTTTGTGAAAAAGATCCTGAGAAAGCCCAGGCGATCAATGAGGTAAGGCGCGGCTATTT
AGCTAAGGAAAGCTACTATGTAGAGGCAAAACTAATGGTGGGAAATGATGGCATTTTGCCTGTGTACTGGTTATTCACCTTGTCAATAGCCCCATACTTT
GGTGAAGTTTATCCAGCGCGAGACCAACTGGCGAATTCGCTTCGTCCACTTCTCGACGGTACAAGCCAAAAATCATTTGTTATGTCACTCAATTGGCAAT
AATTGCATCATGCTTCTTGTTTATATCTCTAGGACTTTGTGTACGATGGTACAAATCCACCCGAACAAGGTTACAAGGAGACCGATGCGAAAACATCCCC
AGACTCTCGTCTCACAGCCTATGGCGCCATGAAATTACGCTTTGACGAATTCTTGCTGAGTCAAGAGAGCCTCGACGGCTTCATCCTTCGCATCGCCAAC
GTTGTGGGTCCGTCGTCTCCGTATTTCCCAAACCAGGTGCCAAAGTTCATGCAGTGGCTGCATCAGCAGCTCTTCCTGGAGAAAAAAGCCCAAGATCCAC
TGACGCTCTGGAGCGACGAGATCCGCTCGTACATCTACGTGCGCGACCTCGTTGAGATCCTGTTCGCGCTGCTTCATTGTGATCAACCATTGAACGAGTC
TCGCACCATGACGCTAGTTAACGTTGGTAAGTTTGCTTTGTGCCACTCATGATTGACTTTGTCGTTTTGAAACGCGCGTTCCTTTGGTCCTATCCTTGTT
TTTGGCATGTACTAGGTGGATTGGATGCGCTGTCACGAGTCGATTTAGCTCAGCAATATTGTGCTGCCTGGGAACGCCGCTTTACTGCTATGACCAAGGA
TGCCGCGCATGGTGTAACAACACGTAAGATTGCACCTACTCGTCGAGTGACCGTGACTCTCGGATACAATCCGCCGTTGGATGCGCGTCTCAATACAGCA
GTGCTTCGAGTCCTGCTTCCGTCCTTCTCATGGACTTCGACGGACACCTTCCTGGATGAGATTTGCCATGAGCTGACCACCAAGTTGAAATGATCCTGCA
CATCATTCATATTTTCTGCAGCAAGTGCTTGAATCTGGGTTTTGATTATTAGAAGAAAGAATTAACAAACTCGTAGCTGCTCAATGGAAACGGTGACTAC
TAAGTTTTTGAAAGGGACAATACAAAATTATACAATCATTTCGGGTGAAAGTCAGGAAACACTCACAATCCATCTTGCAGCGATGCTTCACCCAGCAGGG
CACACACACGGAGCAGTCCTTGATGAGTCACTTGGCTCGCCAACTTACGCGACTTCAACGAGCTCACCAACCGGAGTTTGAGCAAACTGAGCTGGCAGCA
GGTAATCAGGGCGTTCGGTTTGTTCGGCTTCTGGCGCTTCCACAAATGCCGCGTCACACAACGCGATCGAGTGACACGCTTGGCTCGGACTCTTGCCAGC
ACCAACCAAGGTCACCAACTCATCGAACTTGGACGAAAGGACGTCGCATTTGGCGCTAGGAGGAAGGATCGTGCACATGGTTTCCAGCGCAACCTTCGCG
AGGCGGAGTTCGTTCTGGTTTCGCGCGGCGTAAGCCAACATCTCCGCAGTGTATTCACAGAGCAAACAGCCCATCGACATGAACTTTTCGGATTCAACAG
GCTTGGTCACTTGGTTCAATGGTTTACACTCGTGGATGCGTGTGCAGATGGTCTCAACGTCTTCATTGTTCTTCAAAGCATCGACGATGGTGTCGCGGTG
CTTCGTCAGTAGTTCACACTACAAGAACGCAATAAAATCATTAGAATACAATAAAAAATAGTTAAGAATCAAGGTATTGCAAGCTTTCGTACCTCCTTCG
ACTCTGGGATTAGACGGCAAACAGAGTTCATTTCATCAGTGAACGTCGCGAGACTATCAGGCTTCGTAATCATCGACGCGAGCAGCAACGAGTTTTGCTT
GCAAATAGAACAACGTGAAGGCGCCAAGTTAGGGTCCAAGAATTTCAGATCCGACAGCCTGATCGAGTTGACTTCCGCAGCACTCGAGCAGAACTGAAGG
TTCTGGCAGATTTCATGCGGTTGCTTTCCAGCCTTCAGTTGAGATACAGCCGCGTCAAACCACTTCAGGTCTTGGTGGCACTGTGCAAGCAAACGAAATT
GGGTTAAGACATCACTATTCACAGCCAGGACCCAAACATGTAGAATGAAACATACTTTATCGTCAGCCGCTAACAACTCGCATACAATGCCGGCGGCTTG
ACGCGCTTCTCGAACTTGATCTGGTTGTTGCTTCAGCGCATATTCCAGGACCGTGACAACGCCACTGCAGTACGCGCACGTGGTGTTTCCCTTGTCTGAC
GTTGGGCTCGAGGCATTTAAGCTGCTTTGAACAACTTTTTCCATACCACGGGCTGCAGGGCAAAACTTCATGTCGTGACAGATTGCCTTCGGCTTCTCAC
CCTTCTTCAGCGAGTCGATCACTACATCCAACTTGCCAATGTAAGGACGACACTATGTTGTTTTATACACAAAACACATAAGCAGGTTAGTTACCACTTT
CAAATGCATAAAAAAACAGTTGATGTTACCTTCGTGTCCGCTGGTAGGAATCCACACACCAAGTCCGCAATTTGACGAATTTGATCGATTTGGGCTGGGT
CTTGCTCAAGTGCAACTTCAATGACGCTCGTCAGCTGCGTGCAGACAAAACACCCATCGATCGCAGACTCGATCGAATTCTTGACAACCTTCACGAGGCC
TTGGTCAAACGAGGACAGATCCTCATCGCCACGCGTTACTCCTGGCAAAAAAGCGATCTTGGCAGTGCAATACTTCAACCTGATGCAGATTTCACGAGGG
TGCTTGCCCTTATTCAACTGATCGATGACAGTGTC