Description :
From Genome Similarity Track
Location :
Scaffold_43:211293- 212296
Sequence
1003 bases(100 bases per row)
GGCCTGCGTCTCAGGTAAGATGAATCATTGTAGCAGCGGAGCGACTGCAATCTTTGCATTTCGGGGAGAGGCAAGGGTGAAAGGAAGACAGGGAAATTGG
CCGCCTCACGGATAGACACAGCGCTATCCGTAGGTCGGCCGATACACCTTTTAATCCTGGCTCATTAGTCGTTTTGGTTATCGTTAATCCATGTGGTGTG
TCTTCTACGGCAGCGGACACGGCCGGCATCGCGACCAACGATCGCTGCATGGCGACAGTGGTGGCTTGACAGATGCAAATCCTTCCAGGTGCCATTGCTC
GCACGGGATGTCTTGTCGTGTATCACGAGCTCGCTACTCGCCATATCCGGCGGCTCCGGCTGCGGCAGCATGGTCGTACAACATACTACTACTACTAATA
GTATTTTAGTATTAGACGATAGAAACAGTAACAATATATCACAACAACACAAATAAAAAAACGATATAGTATTAGTCGTACAACACACTAGTAGTAATAT
AATTGATTGATACAAATAATAAATAATAGTATTATGTTGATAATAAACACAAACACTAACAGTATTATCAACAATAAATATTGTTAATGACATTATTATC
GATTAAAAAGTAGTAGTAGTATGTTGTACGACCATGCTGCCGCAGCCGGAGCCGCCGGATATGGCGAGTAGCGAGCTCGTGATACACGACAAGCCATCCC
GTGCGAGCACCCGTCGACTCGATGGTCGAGGGTTTGAGCCAGTGGTGCTGTAATAATCAACGGGCCTGCTCGCATCTTCCGCGATGGCACCTGGAAGGAT
TTGCATCTGTCAAGCCACCACTGTCGCCATGCAGCGATCGTTGGTCGCGATGCCGGCCGTGTCCGCTGCCGTAGAAGACACACCACATGGATTAACGATA
ACCAAAACGACTAATGAGCCAGGATTAAAAGGTGTATCGGCCGACCTACGGATAGCGCTGTGTCTATCCGTGAGGCGGCCAATTTCCCTGTCTTCCTTTC
ACC