Description :
From Genome Similarity Track
Location :
Scaffold_63:211272- 213095
Transcript NameFunction/comments
Aphas_H257_15113glycosyltransferase

Sequence
1823 bases(100 bases per row)
CAACGGTCGACGCACAAGCAGGCGTCCAAGAACTACTTCAACCTTGACGCTGACATGAAGCGCCAAAGCTCGATGGTGGACTCGGAAAACCGGTTCAGTC
AACGTCTGTCCATGATGAACGTCTTACCAGGAAAGCAAGCCAACTTCCAAGACGAACCGTCCATCGACTACTGTTGCGACGTCCTCCAAGCCAAGTTTGG
GTTCCAACAAGGATCGGTGGACAACCAGCGTGAGCACGTGTTGCTCTTGCTGGCGAACTGCGCGGCCCGCGCCAATTCCGCGTCGGGGGACAACACGACA
CACCATGTGCGACTGTTGCATGACAAACTCTTTAGCAACTACAAGGAATGGTGCGCGTTTGTGGGCGCCAAGTCGGTCGCGTTCTCGCAGCCGGCTCAAG
GAACCCCGTTGACGTCCGTGCTGCATATGGACCTGATGCTGTACTTTCTCATCTGGGGCGAATCCGCCAACTTGCGGCACATGCCCGAGTGTGTGTGCTA
CCTATACCACCAAATGATGTCGACGTTGATCAAGGACTCGCCGCAGTCGGAAGGTCGCCCGTCGGGATGGTTTCTGACCGCGGTGCTTCGTCCCGTGTGG
AAAGAAGCCACGGTGATGCAAAAGAAGAACGCGCTCGGCAAGCACCTCGAGCACACCAAAGTGCGCAATTACGACGACCTGAACGAGTTTTTCTGGCGGT
CGGCGTGCCTCAAGATCCCCGTCGACAAGATTGGCGGCGCGCTGCATGCCACGGCCGGCAAGACGTTTTACGAGCACCGGAGCATCTTCACGCTGGTGCT
CAACTACTACCGCATCTTTCACTTCAACTTTATGTTTCTGGTCGTGCTGGCCGTGCTCAATTTCGCCGTGACCATCAGTCCCAACGGCGGTACGGTCGAC
TTTTCCCAGTTCGCCCAGATTGGAACCGTGGTCAAACCGTACACGAAGCGCGACCTGAACAAGGCGTGGGCCGTACTTGTGGGATCGCATGCGTTTCTCA
ACTTGTTCAAGTGCTGCCTGGAAGTTGGCCACGGATTCCAGCTCCTCACCGACCCGAAAGCGAGAGCGGCCACGTCGTCGCGCTCGATGACGTATGGCCT
CGCCCTCACGCTTCGCCTGGTGTGGAGTTTAGTGTTTACGGGTGCATTTGCACTCATGTTTACTCTGGGGGCACCGGTGAAAGCGGGCGAGTTCGACATG
CTGAGCCTACTCAACGTTGCGGCGCTGCTGTACCTTGTACCTGGCGGCGCCATCCTCTTGCTGCAGACGCTGATCCCTGGCACGGGGCGGTCGTGGTTCT
CCAAGTTTATCCGCGAAGGCGACAGCTGCTACACGGGCCGACACATGGCGCCGCCCATGGCGTTCCAGGTCAAGTACTATGTGTTTTGGTTCGTGCTGCT
GGTATGCAAGGCCGCCGTGTCGTACTGGGTGCTCGTGGGTCCGCTGGTGCTGCCGAGTCTGGCGATTTGGGAAATGAACCTCAAGTACGGCCAAGGCTCG
ATCGGATCGTTCCACAACATCGGCGTGATTGTCAGCTTGTGGGCGCCCGTCGTGTTTATCTTCAACTACGACACGCAGATCTACTTTACTATCTTCCAAG
CCATATTGGGCGCGTTCATGGGCTGGATGATGAAAGTCGGCGAAGTCCGCGGCGTCGACGCGCTGTCGAAAGCATTCCGCGTTGCCCCCCAGCTGTTTGA
TACCAAGGTCGTAACCGAGTTGGCGCGCCTCGCAGATGCCCAGGAAGGAGGCGGCGGCGGAGATGACGCTGGCCGCGGTAGCCAGTCGGCCGTGTACCAG
TCTCAAATGATGCTCCGGTATGT