Description :
From Genome Similarity Track
Location :
Scaffold_410:21126- 32393
Transcript NameFunction/comments
Phyta_totarag8040conserved hypothetical protein
Phyta_totarag8041hypothetical protein PHYSODRAFT_426731
Phyta_totarag8042hypothetical protein
Phyta_totarag8043copper-transporting ATPase, putative

Sequence
11267 bases(100 bases per row)
ACACCTGGGTTCCCAACCTCGTTCCAGCGCAAGTCCAGCTGACGTAGTGTCCGGTTGACTCGGAGAGCTTTTGCTAGAGCTTTGGCGCCCTCGGGTCcga
tgttgttgttgcgcaagtccagcgtcagcaacCGCTTATCGATTTCCAGCGCACCAGCAAGAGCTTCCACGCCTTGGTCCAGCAAACCGACATTGTTCCA
TTCCAGACTAATGGCCACCACGCTGTGTGAGGAACGCAACAACGCTGCAAGggctcgtgcagcaccagcttcgaAGCAATTGCCTCTCAGATCCAATCGC
GTCGGGACGCTCGCAAGCCGAGCCTTCTCGACGATCTCCGCGAACTTGTCGTCCCCCAAGTACGAATTGCTGTAGTCCAACACGGATTTGGTGGTAGAAG
CTGCTTGCTTCGGGTgcagaagagctgcagcttccgaGTCCTCGTCGAGATACTCTCTCTTCGGTTGGATCGTCATTGGGTCAAGTGCTTGGGACAAGCT
GTCGTTTCGGTCGTGCCCAAGGAATAGCAACGCCCATTCACTGTGCACTTGTACGTTACTGAGGACACGAATGTCTCGCAAGCAACTTCTGGTGCTGCAT
TGAAATTTTACAGATATCTTCTATCTACGCAGACGTCTCCATGGATGGAGTCATTCAGTCCAGCGTTGATAAAATGTCTCGAGACTCTCGCCCCACGTAA
AAGATAATCTTTCGAGCCATTCGCGACACCACGGGCAGGACAAAGGCAGATCAAACAACTGGCAGCTCGCCATCGCAGTTTCCGATGCGGTCAACAAAGA
CCTTCCTGTTCATTCCCGTCTGCTTGATGCCCGAACACTGGCAAGTGTTGTTTCCCTCAACATCTACACGTGGACATCCATCCAGCCATGTGGTACGCCT
CCCCGGTTGACCGATCTGCTGGTCATCATAGTTTtccagctacatgtacacaacCACAAGTTAGGTCCCACCCGTACCAGTTCACACCGTCAATTTCTGA
AAACTACCCGGGAAAAGCCTTGTTTGTCGATGCATCGAGTAGGTGGTTACCACCGTGGTAAGCAACTACGCCCTGGAAATGTGGACGTCGCTATTGAGTT
TTTGCTGCAACCAGTGGGGGTGCACTTGAATTGCCTTGATGTGCAATACGCACGCCATTTGCTGTTCATGTGGATGCAGAATGCTGGACAATAGGCAAGC
TGTAGCTGGAGGCGTTGGTAAGAGTATGCAAATGGGATGTCGCGCCGCAGTTCGCACTCACCGCCAGTATGGAAGATGCAGGTTCAAGTGCTTTGATGAA
CAACTTCCAGGAACGGTATCCATGACAGTAAACCAGAGCGCTTGTGGGGAGAGAGCGTTCGacatgtgctgctgcagccataCATCTGGAATGCATATCA
GTGCCAGGCCTCTGCAATACAATCCAAATCATAACAAGCTATTGGTGGTCGTGCCATACCGTTCGTTACTACGACGCAAGAATCCACCTGGTAAGTAAAT
ATAGGAGATCAAGACAGGCGGTTGGATGGTCTCCCGTGCTGCTCACTTTAAAAAACGCCGTGTGTGTGGTGAGGCTTTTACTCTTAGTTCATCGTACTAT
CAATGACCCCCGTCATCGAAGCCCCTTTAAAGCTGCGTTCGCGGATACAGGAAAGTCTCGATGGTCTCCAATGTGTGGATCTGGTCGAGTGTCCTGCTAC
AGGTCGACTTTTTGTCGACAAGCACACGCTGATGACCTCGTCCACCCCTGAAGGCCGCAatgcaagtgctgctgcgttgaaTGAATTGGACCTCCACCTC
TCGGTTCGGGATGCCGAGAACGTTGTTAAATTCGAGCAGCATTCGCTACAAGGAGAGCGACTCCACCTACTGCACGAACACTGTGCCCGCGGTGACTTGC
TTGACATAATGCAACAAGAACTTCGACTTCAAACGGCAGGTGTGCCGTCTCAAAGCTCTTCAATGTTGACTTGCACCGATGCAGGTAGACGCAGTGTCTT
CACCGCGGTGCTTCAGGGTGTGCAAGCTCTACACACCGCAGGGATCGCCCACTTGGACCTGTCGCCGGAAAATGTGTTCGTCACGGAGTCTGGAGTCGTG
AAGGTGGGAGATCTGGGTCATGCCCAGCGATTCAAGCTCGACCGACCAAGCGTTCAGGTCTTACAAGTTGCCAAAGAGGCCTATGCGGCACCAGAACTGC
TCGCTCGAACTGAAGTGGACGATGCGCGTCGAGTCGATGCCTGGTCGCTTGGTGTCATTCTTTGGACATTGTGCACCAAGCGAGCTTTGGTACGGCGCGC
GTCAAGTGACGGTGACAGGCTCTTCTGTCGAATGGTTGAATGCGGCACGGCTGTCGCTCTCCAGGAGACTGGGCTCCTATCGCAGGTACCAGCGACGTGT
GTCGACCTGCTTGCCGATCTCCTCGAAGTGAACCCCAGATCGAGACTTTCAGTGGCGGCAGCGTTGCAGCACCCGTGGGTGACGCAGGACACTGCACTAA
CTAGACAGCAGTCTAGACGAAAGTCCATTGGCAAcatgatcaagaagaagggcgaGGAATTGATGAAGAAACATCAGCGTCCAAGCGAAAAGAAGACGCG
AGTTCGCACTGCCAGTGCAGAAATTGCACTCGAGTCCACGCGTGTCGCTTTGACGTCCCGAAGTCTAGCCTAGAAGTCTACCAACTGTCACTCACTCGTG
CCTAGCTAGACACACTTATAAGGCTCGAAACGAGTACCCTCAACTATAAACGGGAACGAAAACAAAATGAAACCAACCACGACTTCAGTCTTCAGTCCCT
CCaagccgtcgccgtcgcttGATCCATTTCGTTTGCAGTGGAACCTTCGCCTCAAAGTCATCCTGGTTCGATTCAACTTGGTGATATCAAGAACGGTTTG
GATTTCCGATGCGTCGGCATTTCCTCTTCGCCGAGGACGAAAAGGAACGCAGTGTCGGCGAAGGGAAGGCCAATCTGCTACGACTATGGCATAATCGTCG
AAATGCAATGCTGGAAGGTGACGAGTCTGCCAGCGGAGGTGAAGCAAATGTGTTGGTAGCACGAGAattgacgctgctgtgggaTTTGGCCAAGCCCATG
AATTCGTGCACTTTGAATCGCGAGGGATACGTCGGATTTTTCGCCAGAGCTGCTAAAGCTCTGGTCCTTCCGTTGTCAACCGATTCGCTTGCACTCGCCG
CAGTCCAACGAGACTGGGAATACGATTTGGAAGCTGTCGGTGGTATCGGTGAGTCCACCAAAGCACCTTCAAGTCTGGACAACGAGGTTCTGTCACTCGA
ACAATTTCGTGAGGCCGTCATGCAACTCGCAGACATTATTCTACCCGTGGAGTGTGGGGCCAATGTGTTCGTGACGTTCTTCCGGGAGCTGCGCAATTCT
GTCGCGGAGCAGGTTGTATCTCCTCCCAGTAATGAACCAGAGCAAGACATGACAAATTCTGCTGAACTAGTTGACCGCCTTACGTTACGGCCATTGAATC
AGATCCCGAAGATTACCAACGATGCATTCCTGCAAAAGCTTCCTCCATCGAGGGACGCGTTACGAACTATCCGGGGATTGCAACCTCCTGATCAGCGGGA
GATGTCGTTCAAGCAGCTTCTACTCAGCTACAACCCACGTAAATTTTCACTCACCCGTGCTTTTAAGGCGAATGCTAGGGCCAATGGCAATGCCATCAAT
GTAGCAGAGGAAGCCAAGACGGGTGCCGCAGATACACCCAAACCCAatgtcgaagacgacgtggaggtggCAAAACGACTGCATATCGATCTTATGGGTG
CTATTGGGTCCAGAGCAACTCCTGTCCGGGGAAGAAAACTCCACTGTGAGACTGCGGCGCACTGGGATCCTGAAGATGTACTCACTGCAACTCTAACTGA
GTTTCCTGCCTTGAGAATCGCGATAGTGGGGCCACCTGGCTGTGGCAAAACGCGACTTGCTCGTGTGCTAGCTCGACGACTTGGGCTGAAATATCTGTCA
CTTGACGGAGCTATACAGCGTGCTGTCAACCGAAAGATCCGATTGCGTCGGCGCCGAGTTGTTACTGCTACacctgcagaaggagaagagtCAAGTGTTG
AAACACCGGCATCAGCGGAGACAACGGATGAAGGTGACAAAATCGAGATCGATAATGCTGAggtggatgaagaaatcgATCGCGTGTTTCGAGATGAAGA
TCTCGACACACTATGTGCGGGTCACGTAGTCGCTAGAGACACGGGACTTGGTCTACTTCGACTAGAAGCCACTCGCTCCTTGCTCGGTACGTACGTTGGT
GTATCATCGCAGGAATGGACAATGTTACTCACTTAACGCGTTTTTCATAGCTGGCGTTGGGGTGGTCATGGATGATGTATACCCGTGCGAATTGTCAGCT
TCAGGTGACCCAGAGCACAGCATAGCAGCAGACTATTTGATAGCACTTACAGCATTACCCAACGAGCTTGAGTACCAGCTTCGAGGATCGGAGTTGGCAC
CAGTAGCTGGTCGTTTGTACTCAGCACGGGAGCTTGCCACTTTAAGAACGACAAGTACCGAGGAGTTAGCTGCTAAAGGTTTCGCAGACTTCCTCATTCC
ACCGAAGAAGCCGGGGGTGGAAGCTGAGCAGTTGCAAGAGCCCAACGCTGTTGTTGAAAATAGTGAGGTTGACCCAAACAGCGAAGGCCAGGAAGGCGAT
GAATCTTCTCCTGGAGAAaatgatcaagaagaaaacggAGACAGCGGTCAAGTTGTACTGGATGAACCTGTGCCACCACCGGAGCCGACTCTTGCAGAAC
GCAACGAGATTGAATCGCCCCGAGAAATCACTTTACCATATGGCTCGATAGCTGTGGTAAAACTCATCAAGGGGTATTACGACTACGTGACGCGTATGCA
ACGCGAACTCTCGATGcgccgagctgcagacaaGCAGTCAAACTGTCATTTGGTAGTGGTTCTGGCCACTCAATCCCTCAACGTAATCCGAGACCACTGC
ATACAGGCAATCACGGGAGTAAGTTGCCTTGTTTCACTTTTGTGGTTGTTGTTTTCACTTCTTGACACTCGACTTGCTTGTGCTCTTGGCGTTGTGCTTT
TGTTAGACATCACTAGGTTTGTCGCGCTTCAGTACTTCACGTGAGGTTTGTCCGGTATCTCTCCCCGAGGATCTTAATGGTGCTAGTCGCGCTGAGAAAG
TTAGGTGGTTGCTCTATGGGGACTGGACCacgcttcttgaagctgaatcCAGTGCTGCCACAGAGTCGTTCGCTCGATTTCCTAGACGAGATACTAAACG
CCGATTGCTATCGAAGTGGCGCGAGTTTTGTCCCGTGACGTCGACGTCAGGCAACGCACTGACGCTAGGTAGTCCTGAGTTCGCTGCTTGTTACTCCGGC
CGGGTCTACCTGTTGGCCTCACAAGACGCACGACGTGCCTTCTGTGCATACCCGCTGGAGTTTTTGCGTCGAACTATTCCAGTTCCGTCCAAGTATCGCA
ACTTGTGGCTCGTCACCACAGGTGCTGGGAAGGTCTTCTCACCTTCATACCTGGAGGCGCTCGAGACTGGGCTTCATGTGCAGACTGTATCTCCTTTAAA
GTTGCTCAAGACTTCGCCAAGCATATCTATGGAAATGCGCCTCATGAGTGGACAGGTTGTCTCCCCCGTCGAAGCTGCAACGGTGGCCGCTGAGGCCGTC
AAGACCTTGCTGGCCAAACTGAACACGTCGACAGGGTGGATGATCACGGATTTGCCATTGACAcgcgaagttgctgctgtgttaCTTGAGCACGGATGCG
TGCCCGACGTAATTTTACTGATGGATAGGGaggtcgctgctgctcaagaagaggaggatggGAAGATTGCCGACGCTGTTAGCGCTTTATCTGCGCTGCG
ACGTCAGCAATTTCAGGCTGAAAAAGCTGGAGCCGATGAAATCTCACAAGGAATCGGAGGCGCACCTCGCGTGATAACTTGTCCATTGTTTTGCCAGCCT
GGAGATACACTGGCAGCCGTCGAACGCGAGCTTAATCCAATCGCACCACGTCTGGACAGTATCGAAGACGGACATGCTCCACAGTTTGTCGACGAGTACG
ATCCGGCCGTCATATTTGCCCCACAAGCTCCTGAAAAGGATGAAGAGAATCAGGGAATGCAAGCTTCATCACCAGGGAAAGGAGGCAGTGAAGTCGAAGT
CACGGATCCACAAGAGGAAGCACAAGCCgatgcagcaagaagcagagcacTACAGCTTCAGGGAGAGTTTGGGCGGTTTTGTCCTGTGGCTTGGCGCACG
CGTGGTCTGTTGATACCTGGACTGCCATCAAACGTTTGTTCATTCCGACAAAAGTTTTACGCCTTTGCAGGTGAATCAGAGCGTCACGCTTTCGAGCGAA
ACCCAGCAGCCTTCATCTCTGTGGGGCCGTGCGCAACTGCGAGCTTCGTGCCTTGCGTGTTGCTACTTGGTGTCCGAGGCTCTGGACGGAGCCGAatcgc
tgcagcactcgctcaGCCTCAAAATGAGCAAATAATCCCTTCCGCAGAGTACGTGAATGTGGACTTAGCTGCAGTTGCAAGAAGCGCCGACAGCACCCGA
GTGCTAGAAGAACTCAAACCGGAAGAAGCACGTTTGACGTCTGAAGAAACATTTGTCAaagcgcttcaacgtgagcttcaacgtcaccaGCCAAATTCCG
AGAAAGCAAAAGCACAGGTTATCGCTGGATTAGGGCCGGATCCTTCACACATTCCGACCGCATTGACTTTGGAAACGTGTTTCAAGCACGGACTCTTTCC
AGCACTCGTGATTCCTTTGACAGTGTCGGAGGACGACGTCGTGAACGTTTTAATGGATCGATGGGCTACGAGTCTACCAACACCTCGTCGAAAGCTTGCT
CTCACGCGGAAAAAAGAGGTAGATGGCGAGgccgaagacgatgacagcCCTCCAGAcgatggtgaagaagaagaacccaTAGACGtagaagcagcgcgag
agGAAGAGAGTACTCGAGTGCGCGAACAATTTGCAGAAGACCAAAAGCTTTTGGATGAAGCTGTCGCTGGacttcgagctcgaggaaTCAAAGTCTGCAA
CCCAGTGGATGCCACCAGTGCGCCAAGACAAATGATCAAGCACGTGAGACATATCTTGGACAAATTCATGACAGGACGACAAACGCTATTCGAGCGCTGT
GACGTTCACGACATGGCGGCGGGAGGTAAAATGCATCAGCTGCTAGCGTCAGGAGAACTTTTTGTCGGCAAGCACGGATTTGCCTGCCCCGTTACTGGGC
GTACGGATTCTTCATCGGCTACCTCGGTCAAGGCAGTGGTGTATCGAGACCAGCTTTACTTTCCGAGATCGAGCGAAGCCCGCCGTGCCTTTATGGCTTG
CCCCTCACGCTACTTGGACAAACCAAGTCTTCCACCAAGACATCAACCGACCTGTTCTGTAATAGGTGCTCCATTTTCAGGGAAAACGTGTGTCGCCCAG
GAACTTGCGAATGCACTCGGGCTAGTCTACGTATCGCCCCAAAGCGCAATAGAGTGGGTGGTGCAGTGTCAAGGTGGCTCCACATTGCGGTCTCAGTTGC
TGGAGatcacgaagcagcagaaagagCCTCTACGCAACCTTGATGTCACCCACGAGGCTATCTGTGCTCGACTGCGCTCCTCAGAGTGCCAGACACGTGG
TTGGGTCCTTGATGGgtatctgctgcagcaccacgagtTGCAACGCAGCCTTCCAAATTCCAGCGCGACAGAGGTTGGTTCGCAGAGTATTCAACCAGAC
ATGCTCTTCATTTTGGAGTGCAGCTTCGCGAGTGTCTGGCAGGACCATCATACCCTCGTGGACAGGAACGAACTCCGAGCGGCGTTTGTACGATGGCACC
AGTTTCGACTGGATCTGCTAGATGTTTGGACTCAACGCTTTGGTATTTTCCACGTGCGGCAATTTGACAGCTTAAACAACTCGCTTTGGCACGTAGCGGC
ACAGGCGCAGGCATTtctcctcgagcagcagcagttggcgtCACACCACACCAGAACAATGGTTTCGAACCGAGCTGCCCGTTCATTAGGTGTGGTGCGT
ACGCGTGAAGAACTGCAAGCGCGTCAGCACAACATTTTCCAGACGTTCTGCCCCGTCGAGCTGCGTGCTGGGAGATTTTACATCTCGCGTCAGGAAAACC
GAGAGCTGTGTGTAGATTTCCGTGGCTCCAGCTTCTGGCTTGGGAACGAGCGGAACCTTGAACAGTTTGTCGAAAGCCCTGAGACTTTTGTCGGATGCTC
ATCGGACCAAACTCCAATTCAACGAGGAGACGAACAGTGGCCcacgcaagaagaagcagagagCGAGGCACAGACACTTGTAGCTAGAGCACCAGTAAAT
GCTTCGCTGTTGAGCTTGCTCACTGTGCCGGACTGCGACTTCCCTGAGATGAAAGGGTACTGCCCGGTCACTTTCGCATCGGGTTCGGGCGCCAAAGATT
GGGCTGCACTTCGCCACGgcaacgtcttcttccgTGCTTCGTACCGCTCGAAAGTCTACTTCTTCGCCTCCGATGAAGCACGTCGTCAGTTCTGCGCCGA
ACCATCTCGATATTCTTCTCAAAGCTTGCCAGTGAAATTACCGCCCCAGGTAACACTAGCCAAGAGCTATCCGGGTCAGttggaacagcagcttggagcT
GCACTCAATGaagtgctgcttgcgctggGCAGTGAGCGCCCGAAATTCCCGCAGATATCAACCCGTGCATCAGCCTTCGTCTATCTCGCCCTCTCGCTCA
AAGCGCTGCAGCGACGCTATcagctgaagatgaagatgaagcctGATCCACGCTCGGCACGAGTTGAAGACGAactggatgaagagcagaagCAACGACT
GGAGCGGCGCGAAGAGCAGGCCGACCAGGAAGCTAACGCAAGGCGCGATGCCTTTGTGAGCGATTGCCGGCTAGGAGAGAAGTTGAAAACCGCCTCCACA
CCAGCACACCCATCCTGTGGCTCAGGCGCTAAGGTTGCACGCAGCATGCGCGCAGCACTTGACTCGGTGATTGACAACGAAACAGCGAGCGGCAACGATC
CACTGCCAGTTAGTGAAGAcgttgagctgcttcgtcaCCGCTTCGATTCTATTGTCTCCGCCAGCGCTAATGACGACAAGGTACTGTCAACAGATCCACA
GACAGCACGAATACACGCGAGAACAGCATTCCTCGAGTACACCAAGACATCTACTTCAAGCAAATAAGATCAGAGCACAAAGGTTTCAATGTAGGCAACA
GCAAACCTGTTGATTCTCTGCATGATACGTCTACCTTGTCTTTCGTCTCATCCATGGAGGGCAGTTAgtgctgcttgtgcagcagagGTGTCGACTCGGA
CACGTCAATAGCCACGTGGTTCTGTTGCAGACCCCAGTCGCCACCAAACGGCGGCTTCCACAGGTtaagcagcagcgagaagaggaTCACAGGCACGGAC
GATAGCAGCTCCGACAAACCAGCGAGGGCCGGAGGGATCCAAATTCCGAACGGAGCGTACAACGCGCCACACGCAATAGGCATCATGAGGAGGTTGTACA
TGAACCCCCAAGCAAAATTATGCTTGATACGTCTGTTGGTGGCGTTCGAGAGCGCGCGGGCATTGAGCAGATCACGCAGGTCATCCTTAACCAGCACAAC
ATCGGCGGCGTCGAGCGCCACATCAGTTCCAGCCCCGAGTGCCACACCAACATCGGCCGTTGCTAGCGCCGGCGCGTCGTTCACACCATCACCGACAAAA
GCAACGCGCAGACCCAGACTCTGCAACAAGCGAACCTTGTCTACCTTTTGATGCGGCAAACTTTCAGCCAGCACAGAGCCTTCCGGTACCCCCAGTGCCA
TCGCCACACTCATTGCTGTGCCACGCTGATCGCCGGTAACAATCCACGGCTGAACCCCCTcgcgcttcagctgctcGGTGACACGTTTGGCCTCCGGGCG
CACAGCATCCCGCAGCGCAATTGTAGATAACAATTCGCCATCAATTACAACGAACACCACGATGCAGCCTTGAGACTGGAAACGTTGGTTTGCTTCGACA
AATTCCACGGGAACTCTAAGGGCGCGACAGTCGCCGTACGTCTGCTGTTTAAGCCATGTGAGAGAACCAAGTCGCACGTCAACACTGCCCACGGTGCAAT
GCACACCGCATCCTGGAACAGCCTCAAATCCCTGTGCTTCGTGGACCTGGGAATCTTGGACTTGAGTCTCAGCGTACGCCACGAGCGCTTTACCAATTGC
GTGCTCGCTGCCCCTCTCTGCAACAGCTACGCAACGCCAGAGCTGTGTTTGATCAACGCCATTTTGTGGCGCAAAGACACTAGCAACCCCAAGCTGCGCA
GTTGTGAGCGTCCCCGTCTTGTCAAACACGACAACATCCACTTCCTCGAGCGCCTCGAGCGCGCGGCCACCCTTGAAGAGTATACCGACCTGCGAACCTT
TCGTTGTTGCCACCATTACAGCAGTAGGCACGGCAAGACTAATCGCGCAGGGGCAACTAATAACTAGCACCGTGATTGCAAAGCGCAGCGCAAACGGGAA
AGGAGCCCAGCCCTGCGTATCCACATGGCCATGTTTAGCGAGCGAGTACCAGAGCACGAACATGAAGCCGGCCAGAATGATGATGAACGTGGTGAAGTAT
GCAGCCACAGCATCCGCAATGCTCTGGCGAACACCTCGAGAAGCCTGAGCCTCTCCTACGAGTCGCACCATGCGAGCCAACATGGACTCGTGAATGGTGT
GGGTTACCCGCACGGTCAGAACGCCCTGCGAGTTTATGGATCCACCGATCACAATCGCTCCAGGTTCCTTGGGCACCTTACGAGCTTCACCAGTTACCAT
GGACTCATCCACGGAGCTGGCACCTCCGACAACCACGCCGTCCGTAGGCACTCGAGTACCCGGGAGAACTTTAAGTAGGTCACCACGctccacgagcacc
acgtcaATATACAGCTCCTTCTGGCCCTCTTCTTCGAGCAAGATGGCGGTCTTGGCCTGCATGCGAAGCAAAGCATCCACACTGTTCGAGGCACGTGCTT
TTACCAGTGTCTCGATGTAGCGGCCAACGAGGATGAGAGTAACAAGTAGCACCGTGACCTGGAAAAAGGTATCTGCTTTGGCTGGCGTAACCACTTGCTC
CTGCGGAGATTCTGTCGAAGGATTCACTGGATCTGGCGCTACTTCTGGTGCTTGAGACTTCACGAGC