Description :
From Genome Similarity Track
Location :
Scaffold_31:211248- 236447
Transcript NameFunction/comments
Phyci_92277Hypothetical protein
Phyci_221532Hypothetical protein
Phyci_92280Hypothetical protein
Phyci_92282Hypothetical protein
Phyci_92283Mitochondrial Protein Translocase (MPT) Family
Phyci_221275Hypothetical protein
Phyci_221409conserved hypothetical protein
Phyci_221375conserved hypothetical protein
Phyci_79818conserved hypothetical protein
Phyci_157786unknown
Phyci_453431Hypothetical protein

Sequence
25199 bases(100 bases per row)
CATCTCTTCCTGCCAGCGCAGCTTCTCCTGTCGCCGCTCCTCGCGCTCCTGCTCCCTCTCCAGGTCTCGCTGCTGCTGGGACTCCAGCAGCACCAGCAAG
ACCGTCTGCATCAGCTCCTGGCTGGCCGTCGTCTCGCCGTTCTCGATCTGCGCTCGCAGCGTGCGCAGCCGGTCGCCGGCGACGGGCAGGCGGCTGATGG
CCGTCTGCCACGCATCGTCCCGCATGGGCGTCTCCTGCGCCATGGCGACGCTCTGCGTCAGCGTCTGGCGCAGCTCGTGCTCGCTGGCCGTCACCGCCGG
CTCGGGCAGCGCGTGGCTCTGGCTGGCGGCCTGGGACGTGATCATCTCCACCTCGCTCAGGTCCTCGTGCACCTCCTGCACGTCGCTGTCGGCCACGAGG
TCCTCGCTGAgggcgcgcgcgccggcgacgccgaggccgcggcgctggccgcgcATCTCCTCGCGCACCTTCTTGGCCATGGCGGCGGCGCGTGCGTGCT
TCTCCTTGGTGCTGGCGTCGATCTTGGTGCGGTAGAGCTTGGCGAACTTGCGCTTGAGCGAGCTGGCCGTGCGCTTGTGGCCCGGGAACTGCGCGTTGTG
CATCTCGGCGATCACGTCCCAGCCCTCCTGCCAGCGCTCGCGCACCTGCAGCAGCAGGCCCTCCGTCTCCTGCACGGAGAAGCCGTCGCCGCGCTTCGAG
TAGCCGCGGATCGGGGCCGCCTCACCGTCATCCGAGGACCCTCCTGGCCGCGGCGCAGATGGAGACGAGGGCGCCATTTTTTGGGGAGAATGGGAAAATG
GGGGGAGTTTCGAATGAATGGGTCCGGACGGTCGCGCCATACTGAGACCAAGTGTAGGAGAAACCCTCTCCAAAGCGATAGCACTGGATTTCGCATTTTC
TTAGTCGGCAACAAGTTGCTGTTGCTGACGCAACAAGAGCCTGATGAACGGCAAATGTGCAAGTACGAAACTGTGTTAAGGCAATGTGTTTAGTGAATTA
CTCCAGCCATTTGATGGCGAACTCATTTTTTTTTATCTTACTGTCTCTAAAGACTTGGACGGAGTCGATGGTATCAAGGACTCCATGCTGGCTTCGCTCA
CCATGTCAGCAGCGTTCCTGTGGTGCATCCCTGATGCAACCTCGACTAAGGAACTCGTTGATTTTGGTCTAGCGCTGCTTGGTGCAAGATTGGCAAATGT
GCACTAGTCCCACACAAACTCAAAGTGACCCAACAATTCGTTAGCCCTGCACCATGGTGGAGAATTTGGCTTCTGTGTTGGTTGACTTTTCACGGCGCTG
TCGGTTAGACAACGCTCACATCTTTCTCCGCTACCTGGAACTATTCTCACAAGAATATTATTCTTAAGCCTTCGTTGTACAGTCGACTTCCAGCAACCTT
CTCCTCAGCCCCACGTTGACACGGTTCGATCCCTGAAATCCTACCACGCCTGTCGACACTTCTAGCGTGCATGTATCTGCTGGTACACCCCCCAAGCAGC
TAACAGCAATACCGCAGGGTCAATGCAAACGCCAGGCCTGAAGCGCCGCTGCCAGCGTCTTGTTTAGTGTTCATTTACTGCATCAACGTCTGCCCTTCGT
GGCCTCTCATCTGCCTGCctgctgaccgccgccgctctatttctgctgctcctgctgctgctgcATGATCTCGGCGTAGCTCTCCTGCAGGCGCACGGAC
GAGCGCATGGTGTGGCGCAGGAACTTCTCGGCGCAGTTGTTGACGCAGGACGTCTCCTTGTCGTCCAGCTTCTTGCTGCGGAAGGCGTGCACGCAGTCCG
AGAAGCACAGCTCCACCGTGCGGCTGAAGTACGCGATGGTCTGCGTCACGCGCATCTCCTCGATGTGCTCCTCCATCTTGCGCTCGAACTCCCGCTGGCT
CATGGTGTCGTCGGTCTCGCTTTAGCTGGTCTGCGGCGACCCACCCATTACGATTGCAAAACCGGTACGTCGGTATTTCACCGGTTTTCATAATCAGTCT
TCTCTTTTTTTCATCGAATCTTTGGCGAGCGACCGGCACGAGGTGACCATGAGCGCGACGGCCTGGGCGTCGTGGCTAGACCGGCTGGAGAGCGCACGCG
GCCAGGAGCAGGTGCTGTCCAGCAAGATCCGCACGGGCAACTCGGGCGCCATCGGCACCAGCGTCTTCGCGCTGCAGCAGAGCGTCTCGCGGCTCAAGCG
CGACTTCGACCAGCTCAAGCGCTCCTCCAGCAACGCCGTGTACGCCAGGGACACAGGGGAGCTACAGTTCCGGCCGTAGGGAACTCACCAGTGTGTGTGT
GCATTGATGGACGCTGTGGCAGGACGAAGCAGGAGGTCGAGCGGCGCGAGCGGCTGCTGAACCAATTGGCACAGGACCAGGTAGAGCACTGTAACTACTG
AGCTCCCTGAGCCTCCTTGGCTCTGTATTGATATGGCTGGTGTTCTGTGGCGTGCAGCAAGAGGACCTGGATATGTATAACAGCCGGAAGACCTCTCGGG
CTGCAGTGAGGTGCGTCCAGAGGGCCCGCGGAGGTGTGTAGAGATCACGAGGGCTAACGCCCGTGTGTTGTTGCTGTTGCCGCCCATTTGGCTGCAGTCC
TGGGGCTGCGGACGCGCCGGCGAGGCTGCTGAGCATGCAGAACCAGATCATGAAGGACCAGGACCAGCAGCTGGACTTGATCGGCCAGGGCGTGTCCAAC
CTGCGCAACTACAGCCTGACCGTCAAGGACGAGACCGAGCTGCACGTGCGGCTGCTGAACGAGATCGACGACGATGTGTCCCGCGTCACCGACGGGCTCG
AGTCCGAGGGCGCCCGCGCAGCTCGGGTACGATACGCCGCACTCTCTTGCTCTGCACGGAAGCGCCTGCTTCTTTTATCCTCGCTCACCATGACGTGCTT
GCCGCTCGAGCTGACAACCCCTTTCTCGGTGTGGTACGGCAGGTGGCCAAGCAAAGCAACAACACCAAGCTGTACATCATCATCCTGGTGCTCGTGCTGG
TCCTCATCTTCCTGCTGCTGGCGGGCGGATAGGTAAGCGAGCTATCGCACCCAGCGAGCAAGGTCAGCAGCGTGTGTGTGTGAACTGTACCGGTATCCAT
AGTCCAGCCTTCCTCTAATTTCTCGGGAGGTGCTAACCGTTAGCCCTTTATCCTAACGCAGACGACAAGAGAGGTCCATTTGCCCTCTGACGTCAGCCTC
GACCTCGTAGGCAAAATTTCATTTTTTGTTCCGTTTGTTCCGCCTCAACAGCCCAGCCTCTGTTCACAACCGTATTATAACGTCCAAATGGCCGTCGCGT
TGTGCTGTGACTGCCAAGACGGAGAAGTGGCGAGTCCGCCGAGCGCCATGCAGAACTCGCGCCCGCCGCGCATAACCCCCGAGCAGCAGCAGAAGATGCG
CGAGGCCTACAGCTCGCCCATGCGGCCGTCGCAGTACTCGCGCGGGCCCGAGGACGACAGCGAGCGAGCGGCTGCAGACGGCGAAACGCCGCGCGAGGCC
GCCGCGCGCAGGCAGCGCGAGCGCGTGAGCATGGAGCAGGTGCTGCTGGACCGCCGCTGGGTCTTCCACTGCGCGTCGCCGCTCTTCCACTTCCACCGAG
ACCAGCTCAGCGAGTACGCGCACGACCTGGTGAAGACGCTGCGCGCCGCGGCGCTGCGCGCGTGCGGCCAGCAGCTCGGCTACAGCGTGAGCATCCGCAA
CTCGGACACGTTCGTGGCCTTCCAGATCCGCGAGGAGCGCGACCGGCGGCGCGCCAAGCCCCGGCAGAGCGCAGCGCCCGAGCGCGCGGGAGGCTTCGTG
CTCTACTTCCCGGCCGACGGCGAGCAGCGCGCGCCGCGCAAAGGCCGCGAGAGGCAGCAGGTGCTGCTGCTCAGAGGCAACGAGGAGCTGCTGCGCTGGG
TCTGCTCGTGGCTGCAGCGCCGCTTCCAGTGCGTGGTGGGCACCCACGTCGTGCACATCCAGCAGCTCAACCTCAAGCGCTTGGCGCGCAACTGGGTCGT
GGCCAGTCTGCTGGCCGAAGCTGCGCGACCGTCGATAGCCCAGTCGAACCAGGAAGCGGACGCCGAAGAGTATCCCCGTGGAAGCTCCATGGCCGCGCAA
GAGCCGCCGCGAGCGCCGCTGCTGCTCAAGTACCGAGCGACGAAGGAGGACGACGTGGTGCGCACCTACACGCTTACGGTGCCCTGGTCCACGCTGCGTC
GACTTTTCCAGCAGACGAAGGACGGACCTGGAGGTAATCGCCCGTCTACCTACATACCAGGTACTTTACGTCGTGGCATGCATTTCATGCTGTGCGATGA
GCTGCAATGGTTGACGGGTCTGTGTGTGGTGTTTTGATTGAATTCAGAGCTCATTGAATTGACGGAGCACTTGTACACGGACGCATTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCACGCCGG
CGCAGCGCACGCGGACGCTCGGCCATGGCGCATCTTCCGGTGGCTCCATTGAAGCTGAAATGGGTACATGTACGAAAAATATGGGTACGGCTTTGGTAGA
AATTTTTGGGTACAGTTGGAATGGATACACTAGGAATGGATACACAAGAAATGGATACACTAGGAATGGGTACAGGTGTCATTCGACGACTTGCTTGACT
GGTGGACCATGTTCGCGCAGCTCAAGCGCGAGAGCCTGCGCAAGCTGCAGGCCATGGAGGACAAGAGTCCCAAGGGCTGTATCGACGAGCCCATCGTGGA
CATGATCAAGACCATCAACGCGCACCCGGACTACGTGAGTTGGCACGAGACTGCAAGCGCATTTTGAGCACTGTGTTGACCTTTTCTGAGTGACTTGTGA
CACAGGTGACGAGCAGCTCGTGCTCCGGTCGAATTGCAGTTTTCTGCGGTGAAGCAGCAACGAGCAGCGGCAGTGAAGCGGCCACGGACCTGATCACTAA
AGGCGGCAAGTGGCTGATCGCGGAGCACGCCACCATCACCTTTGACCAATTGGTGGCGGCGTTGCGCTCGCCCGACGCCAATTCAAGCACCAGCAATATG
GTTGGAGTTTGACTTTCTACATTTTTTTTCCAATGGTGTTGTGGCTGATGGTTTTGATGGTATTGCTTTGGTGGTAGATTATTTTCAAGCACGAACCGTT
CATCATGCACGTGGTGTGCCGCGATTTGGAGGCGGCGAAGGAGCTGCTGCAGTGGGGCATTGCGAGTGGCTTCCGCGAGTCAGGTGTCGTACTTGGCAAC
AGGAAGATTATGTGTGCCATTCGCACGACTGCGAACGGACTGGAGATCCCGCTTGGACGCAGTGCTGAGCACTTGCTGGTAAATGAGGACTACCTGCGAT
GGATCGTGGATGTTGCAAACCAGAAGTTTGAGGCCAACAAGCAAAAGACGGATCGCCTCTTCGAGGCTTTCCGTGCAAAGTTTTGCCAGCCGGCGACGAA
TCCACAGACTGCAAGTAGTTCGCAGGTTGTAATGAGCTCGTGGAACGAGGCTTCTAGCGAACACAGTGTCAAGTTGGTGGGACACTCGAGTGTGCAGTAC
AAGGGAGGCCTCACCGTATTCGGCGGCCAAGGTCCCACGGCTTCCGGGACAACGACTCGCGTTGCCGACGTGACGTACTTGACCCCATCTAAGGATGGCT
CCCTTCAGCAGACATACAATGCGGCGGCCGGAGCTGATGGCCCCTCAGCTCGGATGTACCATTCAGCAGTTGTTGTGGAGTCACGTATGGTCGTGTTTGG
AGGTCGCGCTAGCCCCGCGAAACCTCTTGGCGATCTCTATGCTATGGACCTTGAGTCAAAGCAATGGGAAAAACTTGCCCCGCAAGGAAACGGCCCCTCA
CCTCGTTGGAAGCACATCTGTTGTGCAGGTAAGGCTTATTTGCCAAGCTTGACTGTAGCGTTATTGCCATCTTCTTGAACGGAAGAGCTAATCAGTGGTT
GATGGTTAATTTATGTAGTGGATTCGGTTGTGTATGTACACGGCGGCCGTGATGCCGCGCAAGTTTTTGGCGACTTGTATGCGCTGGATTTGTCCCAGAG
CCCGTTGCGATGGCGTCAAATTGGTTCGTGGAGATCATTTTGCTGGTTGACGATCTTTCTACACTCAGATTTCCGGTTAGCTCATTTTTGTCGCTTGTAA
ATGCTTACAGAGAATTCGCCCAACATTCCACACCGATTTGACCACATCGGTGAAGTTGTCAGCTCAACCAAACTTGCCTTGTGGGGAGGCATGACTTCGC
TAGAGGGACCCGATGGGACTGGTGAAGATGCTCACGGGATTTGCTCGCTTTTCGATACTGTTAAGGAGTCCTGGGAGCACAAGACTATCAAAAATGCCAG
GAACAGCGGTCAACCACCCGCGCTTTTTGCTGCTAGTGCCAGCTCAATTAGCGATCACCAGATTTTGGTGGTTGGCGGTATGACGCCTACTTTGCTCGCG
AATGGAGACAAAGCCACCCAGAAAGTGTACGTCCTGAATGTTAAAGCTTCGCAATGGACGGAGGTTGGTGAAGTGAAACACGAAAACGCAGTTTTCGTGG
GCCACAGCAGCACGTGGATGCCGAGCAATGAGACCCTTTACATTCTGGGAGGTGGCTTCCAGTGTTTTGGCTTCGGGCAGGTTTATTCGTCTGCGTATCA
GTGTCAACTTTCGATCACGGCGCCGACAAAAGCCCCGTCTAAGGCTGCAAAAAGCAACGCAGTTGTTACTCTCAGTGCGTCAGCCTCTTCAGCTGATAAG
CCTCTCGGCGTCCTTGTTGGAAAGTTGCAAGTGAAGAAGGTGAAAACGTTGTTGGAGAAGGCACACGTGTACGACAAGGCTCGACGGGTGCACGTCGCGA
ATGTCGTGCCTTCTAGTGCGGCTGCTGCTGATGGTAAGACAACAACCATGTTCTTGCTCCCGGTTACTACAGCTATTCAAAAACTGATTACCTCGACCGA
CGACGCTGAACTACAAAGGCTTGAGGTTGTACCTGACGACGATGCATACGCTAATAAGTTCGGCAAGACGAGTGGGCTGAACCGCAACGAAGTCATCCGC
AGCACAATTGGAGCATTTGCCAGCAAGCACCAAATTCCTGCGGAGATTGTGAAGGCTATTCCGGACAAGTACGAGTTCGTGAGCGATGTCTTGCTGATCC
CGCGTGATTCCTTCCTGGAGCCGGAGTGGGCGCCGTTCGCAGATGAAATGTGGGCTCACGTTTGTGCGTCGACTACACCCGCTTTTTCCCGCGTTGCTCA
GAAAGCCTTTATCGATGCCAGTGAAAAGCGTCAGAGTCACGTGGAGCTGCTGTACGTAAACAACAAGCTACTACCCTCCCAACGTAGCAAGGAGGCTCCT
GGTTGGGTGGAGATTCGTGAAAACGGCATCATCTACGGCTGGGATCTCACCCGGGTGATGTTTTCGTCCGGAAACGTTACTGAAAAGGCCCGCATGGGGA
ACATTGGGTGTCGCGGAGAGACTATTGTGGACCTCTTCTGTGGCATCGGATACTACGTTCTTCCGTTCCTGGTGCATGGCGGTGCGGCGTTCGTCCACGC
GTGCGAGTGGAACCCAGACTCCGTGGCAGCACTGCGCTTCAATCTGGAGCGCAACCATGTTGCAGGCAGGTGCAAGGTGTACCTCGGTGACAACCGCGAG
TCGGCCCCTACCATCGGGGCCGTGGCTGACCGTGTGAATCTCGGTCTTCTGCCCACGAGTGAGAAGGCTTGGCCGCTGGCCGTGCAAGTGCTGAAGCCCA
GCGGCGGGTGGTTCCACGTCCACGACAACGTGGCCGTCGAGGACTTCGAGGCATGGCAGCAGCGCGTGCTGGACTCGATGCGCTCGCTCGCGACGCAACA
CGGCAAGCACTGGACCATCACGTGCGAGCACGTGGAGAAGGTCAAGTCGTATGCCCCCAAAGTGTATCACCTCGTCGCTGACATCCACTGCGTGCCAGCC
TAGTTGCAATCTGTACGATGACTAATCTACCCAGACATTCACTAGGATGCACTTGCATCTTGAAGCTGCTGAAATTCAAAAAATCTAAGGCGGCGGGACT
TTTCGCGCCTCTGTCCGGCCTATTTCACTTAAGTGCGCTCGACGTCGAGCAACGATTGGCCAGCACGAAATTTTGTGTCCGCCCACACGTCTCACACATC
TCGTTTGCTCCCCCCCAATCGCAGACCCAGGAACCAAAAGACCAAATGGCCGCACGCTTTTCGCCGCAGGACGTCGCGCTGGAGCCCGAGGGCAAGCGGC
GACTCGGGCCGCACGTGCAGCGCCGCGGCGACGGCTTCACGGAGGCCGAGTCCATGGGCCTGCTGCAGCTCGTGCGCAGCCACTGGCGCGAGGGCTGGGA
GATGATCGCGCAGCTGCACAACCAGCAGTTCGCCAAGCACAACCGCTCGGCCGACTCGCTCAAGAAGAAGTTCTCGCGCCTGTACCGCTCCACGGTCCCG
CCGCGCGGCGCCAAGAACTACCAGGCCATCACCTTCGCCCACGTGGTGCACAAGGAGATGATCGAGGGCGTGCCGCCCGCGCCCGGCGCGGTGGTGCCCG
GCGTCGACGGCGAGCAGATGGAGGCCGCCTTCCAGCCGCCGCAGCCCGACGAGCGCGTGCAGGACGGCGCCACCGAGTCGGAGCACAGCTGGGTGGACAC
GGCGTCGGAGGTGGCTCCTACTGCTGCCGCCATGGCCGCGTCCTCTCCGGGCCCCGCGTCGCTGGCTGCGTCGCctgctgcagtggctgctgctgttgcg
gctgctgcACCGCGTCCACGCGTGCGTGCACCACGTTCTGAGTGGCAGAACCCGGCCGCCGCCTTCCCGCCGGAGGCCACGCCGCTGCCGACGGACGACC
TGCTCACGTCGGTGCTCAAAGTCATTCTTCGCTCGCAGTACCAGCGGGATCTGGACCGGGAGGAGGAGCGAGCGCGTCGCGATGAAGAGCGGCAACGCCG
TAGGGAAGAGGACGAGCAGCGGAGACAGGAGGAGGAACGCCGACGCGACGAAGAGCGCGAGGAGCGGCGTCGACGCAGTGAAGAGCGCGCCGAAGAGCGG
GCGGAGAACCGCCGGCGCCATGAACAGTTCATGCAGATGATGATGATGCTCGTCGGCAAGAACGGTGCCAGTGAACAGCGAGACACGGACTGTTGAGCGA
ACGCATTTCTCATGGTTCTCATGTGTTTGCTTCACGTTGTGCGTGCAGGCTGTGCTGGGGCGGAAGATGCCAACACAGTCGGGCGTTCGCGCCAGGCGAT
CGCTCGAGTCTATTTCATATAGGTATGGTGTCTGCAAATTGACTTGTACAAACGCACTCGCCACTGCATCAAGCTCGAAACAATCATCAAAGAGGTCAAA
CCGCTCACTGCCTACTCGCCCACGTTTGCCGATTTGTTTGCTCACTTACTCAAAGCGAAGggatactcgcccgtttgcacggtgaatgtggcgcagaggg
gattggcgactacggtctcgttgtacTGTATGACGGAAACGcggaccttcaccgaaaatctcgtacgcacggggccacgaagcggagtgaagactctagg
agtacccacagccggggaatctctgtccacgataccccatttcatacatcaacgcggggttgaacgaagctgcactatttatctggtgatcaaaaaTGAC
AAACCCCAGCGTCATGCAAGGAGTGCCTCAGCTGCAATCCAAGGAATAGTCGGATCGTGTCGAAGGCCAGCTCAGCAGCTTACATGTAAATACTTGTTGC
ATCTCTGGTTTGTAGATCACTTTCGTGTCGTGTCTACATGGATCAGTGAAACTTCGTGGAATTCCTTCCAAGCTACAACGGTACCACTTGCAACTGTTCA
TCACTTATTATTATCGAAACCATGCATTACCGGTACACTAACGCTAGCGGGGACACTCGCATTGCACTGCAACAGCCGACAACCCAAGTGCACGCAAGAG
CCTCCGCCTTGAGACCAAGCTCAGTTCAACCCGGTCCGCTGTTGCTGTGCCGCAGCGATCTGGGCCACGAGCGTGGTCATCACCTGCATGAACTGTTCGT
TCCTGCGTCGGTCCTCGGCGCGGTCCTGTTCGACCCGGCGCCGCTGCTCGCGCATCTCTTCCTGCCAGCGCAGCTTCTCCTGTCGCCGCTCTTCGCGCTC
CTGCTCCCTCTCCAGGTCTCGCTGCTGCTGGGACTCCAGCAGCACCAGCAAGACCGTCTGCATCAGCTCCTGGCTGGCCGTCGTCTCGCCGTTCTCGATC
TGCGCTCGCAGCGTGCGCAGCCGGTCGCCGGCGACGGGCAGGCGGCTGATGGCCGTCTGCCACGCATCGTCCCGCATGGGCGTCTCCTGCGCCATGGCGA
CGCTCTGCGTCAGCGTCTGGCGCAGCTCGTGCTCGCTGGCCGTCACCGCCGGCTCGGGCAGCGCGTGGCTCTGGCTGGCGGCCTGGGACGTGATCATCTC
CACCTCGCTCAGGTCCTCGTGCACCTCCTGCACGTCGCTGTCGGCCACGAGGTCCTCGCTGAgggcgcgcgcgccggcgacgccgaggccgcggcgctgg
ccgcgcATCTCCTCGCGCACCTTCTTGGCCATGGCGGCGGCGCGTGCGTGCTTCTCCTTGGTGCTGGCGTCGATCTTGGTGCGGTAGAGCTTGGCGAACT
TGCGCTTGAGCGAGCTGGCCGTGCGCTTGTGGCCCGGGAACTGCGCGTTGTGCATCTCGGCGATCACGTCCCAGCCCTCCTGCCAGCGCTCGCGCACCTG
CAGCAGCAGGCCCTCCGTCTCCTGCACGGAGAAGCCGTCGCCGCGCTTCGAGTAGCCGCGGATCGGGGCCGCCTCACCGTCATCCGAGGACCCTCCTGGC
CGCGGCGCAGATGGAGACGAGGGCGCCATTTTTTGGGGAGAATGGGAAAATGGGGGGAGTTTCGAATGAATGGGTCCGGACGGTCGCGCCATACTGAGAC
CAAGTGTAGGAGAAACCCTCTCCAAAGCGATAGCACTGGATTTCGCATTTTCTTAGTCGGCAACAAGTTGCTGTTGCTGACGCAACAAGAGCCTGATGAA
CGGCAAATGTGCAAGTACGAAACTGTGTTAAGGCAATGTGTTTAGTGAATTACTCCAGCCATTTGATGGCGAACTCATTTTTTTTTATCTTACTGTCTCT
AAAGACTTGGACGGAGTCGATGGTATCAAGGACTCCATGCTGGCTTCGCTCACCATGTCAGCAGCGTTCCTGTGGTGCATCCCTGATGCAACCTCGACTA
AGGAACTCGTTGATTTTGGTCTAGCGCTGCTTGGTGCAAGATTGGCAAATGTGCACTAGTCCCACACAAACTCAAAGTGACCCAACAATTCGTTAGCCCT
GCACCATGGTGGAGAATTTGGCTTCTGTGTTGGTTGACTTTTCACGGCGCTGTCGGTTAGACAACGCTCACATCTTTCTCCGCTACCTGGAACTATTCTC
ACAAGAATATTATTCTTAAGCCTTCGTTGTACAGTCGACTTCCAGCAACCTTCTCCTCAGCCCCACGTTGACACGGTTCGATCCCTGAAATCCTACCACG
CCTGTCGACACTTCTAGCGTGCATGTATCTGCTGGTACACCCCCCAAGCAGCTAACAGCAATACCGCAGGGTCAATGCAAACGCCAGGCCTGAAGCGCCG
CTGCGAGCGTCTTGTTTAGTGTTCATTTACTGCATCAACGTCTGCCCTTCGTGGCCTCTCATCTGCCTGCctgctgaccgccgccgctctatttctgctg
ctcctgctgctgctgcATGATCTCGGCGTAGCTCTCCTGCAGGCGCACGGACGAGCGCATGGTGTGGCGCAGGAACTTCTCGGCGCAGTTGTTGACGCAG
GACGTCTCCTTGTCGTCCAGCTTCTTGCTGCGGAAGGCGTGCACGCAGTCCGAGAAGCACAGCTCCACCGTGCGGCTGAAGTACGCGATGGTCTGCGTCA
CGCGCATCTCCTCGATGTGCTCCTCCATCTTGCGCTCGAACTCCCGCTGGCTCATGGTGTCGTCGGTCTCGCTTTAGCTGGTCTGCGGCGACCCACCCAT
TACGATTGAAAAACCGGTACGTCGGTATTTCACCGGTTTTCATAATCAGTCTTCTCTTTTTTTCATCGAATCTTTGGCGAGCGACCGGCACGAGGTGACC
ATGAGCGCGACGGCCTGGGCGTCGTGGCTAGACCGGCTGGAGAGCGCACGCGGCCAGGAGCAGGTGCTGTCCAGCAAGATCCGCACGGGCAACTCGGGCG
CCATCGGCACCAGCGTCTTCGCGCTGCAGCAGAGCGTCTCGCGGCTCAAGCGCGACTTCGACCAGCTCAAGCGCTCCTCCAGCAACGCCGTGTACGCCAG
GGACACAGGGGAGCTACAGTTCCGGCCGTAGGGAACTCACCAGTGTGTGTGTGCATTGATGGACGCTGTGGCAGGACGAAGCAGGAGGTCGAGCGGCGCG
AGCGGCTGCTGAACCAATTGGCACAGGACCAGGTAGAGCACTGTAACTACTGAGCTCCCTGAGCCTCCTTGGCTCTGTATTGATATGGCTGGTGTTCTGT
GGCGTGCAGCAAGAGGACCTGGATATGTATAACAGCCGGAAGACTTCTCGGGCTGCAGTGAGGTGCGTCCAGAGGGCCCGCGGAGGTGTGTAGAGATCAC
GAGGGCTAACGCCCGTGTGTTGTTGCTGTTGCCGCCCATTTGGCTGCAGTCCTGGGGCTGCGGACGCGCCGGCGAGGCTGCTGAGCATGCAGAACCAGAT
CATGAAGGACCAGGACCAGCAGCTGGACTTGATCGGCCAGGGCGTGTCCAACCTGCGCAACTACAGCCTGACCGTCAAGGACGAGACCGAGCTGCACGTG
CGGCTGCTGAACGAGATCGACGACGATGTGTCCCGCGTCACCGACGGGCTCGAGTCCGAGGGCGCCCGCGCAGCTCGGGTACGATACGCCGCACTCTCTT
GCTCTGCACGGAAGCGCCTGCTTCTTTTATCCTCGCTCACCATGACGTGCTTGCCGCTCGAGCTGACAACCCCTTTCTCGGTGTGGTACGGCAGGTGGCC
AAGCAAAGCAACAACACCAAGCTGTACATCATCATCCTGGTGCTCGTGCTGGTCCTCATCTTCCTGCTGCTGGCGGGCGGATAGGTAAGCGAGCTATCGC
ACCCAGCGAGCAAGGTCAGCAGCGTGTGTGTGTGAACTGTACCGGTATCCATAGTCCAGCCTTCCTCTAATTTCTCGGGAGGTGCTAACCGTTAGCCCTT
TATCCTAACGCAGACGACAAGAGAGGTCCATTTGCCCTCTGACGTCAGCCTCGACCTCGTAGGCAAAATTTCATTTTTTGTTCCGTTTGTTCCGCCTCAA
CAGCCCAGCCTCTGTTCACAACCGTATTATAACGTCCAAATGGCCGTCGCGTTGTGCTGTGACTGCCAAGACGGAGAAGTGGCGAGTCCGCCGAGCGCCA
TGCAGAACTCGCGCCCGCCGCGCATAACCCCCGAGCAGCAGCAGAAGATGCGCGAGGCCTACAGCTCGCCCATGCGGCCGTCGCAGTACTCGCGCGGGCC
CGAGGACGACAGCGAGCGAGCGGCTGCAGACGGCGAAACGCCGCGCGAGGCCGCCGCGCGCAGGCAGCGCGAGCGCGTGAGCATGGAGCAGGTGCTGCTG
GACCGCCGCTGGGTCTTCCACTGCGCGTCGCCGCTCTTCCACTTCCACCGAGACCAGCTCAGCGAGTACGCGCACGACCTGGTGAAGACGCTGCGCGCCG
CGGCGCTGCGCGCGTGCGGCCAGCAGCTCGGCTACAGCGTGAGCATCCGCAACTCGGACACGTTCGTGGCCTTCCAGATCCGCGAGGAGCGCGACCGGCG
GCGCGCCAAGCCCCGGCAGAGCGCAGCGCCCGAGCGCGCGGGAGGCTTCGTGCTCTACTTCCCGGCCGACGGCGAGCAGCGCGCGCCGCGCAAAGGCCGC
GAGAGGCAGCAGGTGCTGCTGCTCAGAGGCAACGAGGAGCTGCTGCGCTGGGTCTGCTCGTGGCTGCAGCGCCGCTTCCAGTGCGTGGTGGGCACCCACG
TCGTGCACATCCAGCAGCTCAACCTCAAGCGCTTGGCGCGCAACTGGGTCGTGGCCAGTCTGCTGGCCGAAGCTGCGCGACCGTCGATAGCCCAGTCGAA
CCAGGAAGCGGACGCCGAAGAGTATCCCCGTGGAAGCTCCATGGCCGCGCAAGAGCCGCCGCGAGCGCCGCTGCTGCTCAAGTACCGAGCGACGAAGGAG
GACGACGTGGTGCGCACCTACACGCTTACGGTGCCCTGGTCCACGCTGCGTCGACTTTTCCAGCAGACGAAGGACGGACCTGGAGGTAATCGCCCGTCTA
CCTACATACCAGGTACTTTACGTCGTGGCATGCATTTCATGCTGTGCGATGAGCTGCAATGGTTGACGGGTCTGTGTGTGGTGTTTTGATTGAATTCAGA
GCTCATTGAATTGACGGAGCACTTGTACACGGACGCATTGCCATTCGACTTGTCGACCTACGAGATCGAGCGGGTTGAGATGCAGGATGTGGCTGTGGAC
CTAGACGGAGGCGTAGAGGTAGGTTCTGCCAGGGTTGAAGAAGCTACCTGGTTAGATGTTGCTGGCTAACTCGATGTGCGTTGTTGACGTCCAGTTTTAC
AGCATGGACCTCGTGCACACCGTGCTGTTCAGTCTGCTGGAGCTGCTTGCTGTACAAGATGTTGCCACGACTTCGCGGCCGGAGACGACGTTGTGAGTAA
ATATGACGCAGCACCCCACCGATCAAGCTATCGAGATTCTCCAACTACACACACACACGTGCCATACCACCGAGCAGCTAGATGAGGTGCTCCTAGCGCA
CGTAGCGACTACATACGGATATACTGTTTTGCAATTCATTCAACATTCAAAATTTCTAGCTGAATGACTTTGGAGTGCCATTTTGTCACGTGCTATGAGT
ATCGACTCAAGTCCAGCTTGGTTGCAGTGGGACCACTGCCCTGCGAAAATGACGACGGTGCGCGTGCCCCCGCCGCGGGCGCTGAGCCAGTGAGAGCGAG
GCGAAGCGCAGTCTCCAGCACACCACGCAACGTAGGCGTCATGGCTGCCACTGCCTCCTTGAATGCAGCAGCATGTGTTTGCGCGAAGCATAACAACAGT
CGCGCCAGGATGCCTGGAACCTGTGAAGGAATCGCGTTCTCGGCAGCTGTCGGAGGTGGATTACTGAGCACTACCGCAAGTCTCGGGAGCAGCATGTGTA
CAAACGCGGCGCCGTGGTGGTCATTCAGCTGCGTCGTCAATAGGCGAAGCAGTCCCTCCGCTTCATCCAATTCAGCGAACTCTGCAGCCGTTTCTGGGTA
GTTTGTAGAACTGACGATCTCTACGAGCGAGGGGCCAAGTGCCGCCAGGTATCGATTCGCAATGGAGCTTTGATGCATGTCCACGAGCTTTTTCACAACT
GCGTGCAAACCCCGCAGAAGATCTGCGCGAGCAATCGCAAGCTGCTGCCTCTTAGCATCGCCATCGTCTGTACCGGGCGCAATTTCCAACACTGCCGAAG
CTGTCTCTGCTACATCAGCATGAAAGTGTTCCGCATCGTCTTGGAGGCAAGCCGGGAAACTTGCAGCAAAATTCGCTGCGATCTGCATCGAAAATCCTGG
GGCACTATGAATGTCCACCTTGAGCCACTCAGAAAGGAACTCGAAAGAGCTGCGCACGCTTGACTTGATCCGAGTCAAAACATCCTCACCTGAGTCGCTG
CTGGTTTCAAGTGTGCGTGCCAACGCAAATACCGACTCGGTGGAAGCACGACTGAGCGTCACCACTGCTTCTTTTACAGAAGAAGAATGGTAGCTACTAG
CAACCGAACAAATGGCCTGCTGCACCATAGCAACTGAGCGAACCACCCCACTTCGCGCTTCTTCAGTAGTGTGCAGAAGCACAATGCCGGTTGTTGCAAA
CTTCACAACCTCAGTCATGTGCTTTGAATCTTCTTCACTCGCGATGGGGCTGCGGCGAGATCCTGTCGTCCTGCTCCCGATGCTTACTGCTCGAGCGTGC
CGAGTCTGTTCGCTCGCGTCGCACAGATTGCATACCACTTCGGTTGGGCACAGCCCTGCTTGTGCGACGACGTCAAAAAGCGCAGCACTACTCTGCTCTC
CATCCTCCCCAGAGCGACACATATCTCTAGCAAATGCTAGGTTTTCCCGTGATAGACACAAAAAAATTGACTTCAGAGCTTCCAGTTGAGAGGGACCGGT
GCACCGCTTACTGACCAGCATCAGCGCATTTAGTGCTGTTGTTAGAAGCACTGGGAAATTGCTGGACGAAATACCACATTGCTTTGAAGGGTTCTCAACC
AAGGCCCTCAGTATTAACGGAATACTGCGAAGAACTGCTGGTAATTCCGTGTCGTCCTCCATTCGGTCACGAGCGTTCGTGTTCATATGGAAAATTGCGC
TTGAAAGGATCACGGACGACCACTTAGGGATATTGCCCTCCGGTGTGTTGAACAAAGACACGGACTTCGGCACATAAACTTCCAGTATCGCCATCGCATT
TACAATCTTTGGCCAGAACCGTTTGTAAAGCGAGCGCAGTGCTTTTGAAGCTGACAGAGCAGCTGCCGAAGCAGTGGCAGCAGGTCCGACCGGTGGAAGG
GGTAGTTGCAAGGCTGGCATCACCATGGGTTCATCATCCTGTAATGCTGCAGAGGAGGGCGAGTCCAGCTGTGCCCAATGAGCGCTGCCCTGCATCACAA
CACCGTACGCGAATGTCGTATCCATCCAGCACTTGAACAAGTACTCAGTGGTACCCGACAACCCGTTGGTCATTGCTTTTACAAGTGGGGATGCCGTGAT
AGCTCTGCGTTCATCGTCGCGCGCATCCTTTTGAGCGATAGCTTCCGTCACACATGACGTTAGAAGTTCCCCCACAGATGCCAAATTAGCGAGCGCGAGC
GAAGTACGAGTGAGTTCATCTCCAATGAAGTGCGCGTGGCCATAATCAGGTGTCACCACTGCTCTCAGAATGCGCCCCAATCCCACCTTGTCTTGAATAA
GATGAGCTGAAACACAAGCGCCAGCAATGCCGTGTGCCTCGAGAAGAAGTGGGGCGTAGAAATACGTTTCTTCGCTCCTGTCATTTTCCGTAGTTTGGGT
CAACAATGAAGACTCGACTTGTACCTGCTTGAGAGCATGACGAATGGCAGACGAAAGCTGGGCTCGATACGGATCCAACAAGTACGCATCACCCGTGGCA
ACTTCAGGATCGCGAGCAGACGCGAAGTTTTTCACTAACACGTTGAGCAGTCGAAGACCCACGCACTGGAACATAAGAAGCTCATCTCCTTCGGCCGATG
TCGTGGTTACGTGGCATGCGAGGGTGACAAATTCGTCCAGGTACATACACAGGAAGTTACCAATGTTGGACTCTGTGGAGATCGGCAAGGCTGCTCCAGC
AGCAAGCATTTCGAAGAAGTAGCGGCGCGCCGCGACAAGGTCAAAATGAAGCTGCTTGGTTTGGCAGATGCCGGTTGCCACGGGCGGAACTGCCGCCATT
AATTCGAACACTCGAAGCACACACTCCACAGCGAAGTGACGTACTTGTCGAGAAAGCGGTGGCATCAACGCAATGAGCTCACCCACGCTTGCCTTTGTTG
CTCGCCATGTATCCACTTGGGTAGCAACAGCAGCAGACGCAAGCGAGTTAGCATCTGCCGTGGGTAGATCTAGAGTTGGGTTGGGCGACCATGATGAGTC
ATCATCTCCCGAAGCCTCGACGTTTTCTGTTGCCTGAATACCAGGATGGATTCCTTTCGGACTCATCATCAGCTGCTCTGCACTTACCCCCGCAAAAGTG
CTTGCAGATTCGCCGATGGCAATACTGCGGCACAAGAGGGCCCACAGGCAAGGCTCGGCGCCTTCATGGTCTCTGCCTTCTACATCAAGTAGCGCCAGGG
CCGTGATTTGAAGAGCGCTAATACCATTCCGTTGCATGGTCGAAGAATCTGCAACAGCGAAAGAGAGCACGTCCCACATTCCATGCAACCCGGGCAAGTA
GCTCCACATGAGCTCGTTGTATTCGACGTGAAGTGCGGAGAAGAGCAGACAAAACAGGTTCTGGCGGCGTATTAATGTCGGGTCCCTTTCCACCAGCGTA
CGGATACAAGATAGTCCAACATTTTGCAAGATACTGCGACTCCACCCATTTGTAAAAGCACCGACATTGACGAGGTCATTTTGCTTGAATGGCTCTCCGT
AGGCTCCTAGGATACCCACAGAAGGGCCAGAGTTTGACGGTGGTGACAACATCGGCGCCCCTGAGCTCTGTGGTGATGCCAATGACGACGACATTGCTGA
GTTTAACAGAGCGGTGTCAGAAATGATACGCAGAATATACATCAAATCGGGAGATTGAAAGCGAGACGGGGCAAACACGACTACTTGCTCAAGGAACTTC
AAAAACTCCAACTCGACTCGTGCGTCACCCTCCTGACGAAGAAGCATCCAGTACGAGTAAAACTCGTTCAAACGATCGCTCGAACCATCCAGTTCTGGGC
CGAGCGTTGCTACCACATCGTTAATAATTCGCCCAAGGGCAACCTTTGTGCTGATTTGCCAACGGAGTCCACGCTTATTGACTTTGGAATAAACAAACCC
AGCCAATACGTGAGCTTCCATGAGAGAAAACGTTGAGTTCACAAACTGCTCGTAATCGCCTCCAGTTGAATTGACGGACTCCAAGATAATACTCCAAGAA
TGCAAGATCCACGTGCGCAACGGTTGCGAGCATTCACCGGCAAACCGGAAAATGAGTCCTGTGTCAATGGAGATGCGTGAGCCGCACACGCGCTTAATGC
AGGCCAGTGCAAAAGCTGCACCAGCTGACAGAACAGAAACGTCTAAGTCAGCGTTCGAAGCCCCCTGTGGGAGTTTATCCACCACCAAGCGCTTTTCCAA
TTCGATAATCAGCCCCTTGCAGTGATCTTCCCCAAGCAGCAGCGCCAGCGTGCCGAGCGCCTCGCCTGCACCGCGACGAACCTCCGCATTTTCACTCGAA
ATCATTTCACAAAGCATGGTTTGCATTTGAATAGGCCAAGAGGTTGCAGAAAGCGACGCCGACAAAGTCGGCGCGGCACCGGATTTTTCAAGACGCCTAG
CTTCAGCGATCACTGCAAATAGCACGGAGCACACGTTAACTTCGCAGTCCGCGCGCACATCCGTTAGGGCTCCTGCGTAGTGTTGGAGACACCGGAGCTG
TAAATCTTCCGGGATAAAATGGAACAGCCGACCAAACAGAAGTACGCTGGCATCGACAAGGCGAACGTATGTGAATGGGCTGCAGCTTGCACGCTTTGCT
CCGCCTTCCACAACCTCTTTTTCAGTGATTGATCTCCAAAACGTGTCGAGATATTGCACCTCAATTTCAGTATCCGTCAAAGCATTTTCCCGCTGCTGCA
ATCCAAGCAAGTGATTCAGCTCCCTGGAATACAGAGGAGACGGGTAGTCCCCTGGTTCCAAGCGCGAAAGGGTCACAATATCAAGAGCGTTGTCCTCCGA
CGAAAGCACGCTTTGAAGGTATGTAGACTTTGCCGGCACCATTGAGGAATGCCGAAGATTTGTTAGCGCCTGCGCGGTGGTGAATTCCGCGATTAAATCC
AATAGCACGATGTACGAATCGCTGTAAATTGGTGGGAGCATCGAAAAACAGTTGATAATCCACCCCATTAGGCGAAATCGAGCAATTTGACCACGCCGCT
TGAGAGGGTTGCTAAGAGTATCCTGCGTTGCAGTCAAGTACACGTGCAATATGTGACTCGCGAGAAGATTGACATCATTATCAGGATCTGCCGCAAGACC
CTGGCAATTGGCCAGGAAGCTGCTAAGCGCAATCACGGCAGCTTCGATGCGCAGAAGCTCGAGAGATGATTCACGACTGTGGAGCACACTGGACTTGAGC
CATAAGTTCAGGAGTTTTTCCAAGTTGGCCTTTATCCATTTCTCGTTGTTCATCGAAACCAGACTTCCCACCAACGTCCAACCTGCGCGTGTGCACGTGA
GCCAAATGCTATCTGCGCATTCACTGAGAAACTGACTTTCAACGAGCTCCTCGGAAATGGAATAGATATCGTCCATAATTGCTTGGGACAATCCTCCATT
GGCGTCAAGCTTAACGGCACGGAGGATATGGGCGATCGCCGTGGATCTACCCTGAATCGCGTACAAGTGCGTCTTGCTTTGCATCTCATTGCCTTCATCT
TGGCCATCCTCAGCCTTCTCAGCTGGCTCCGAATTTCTTGCTTCTTCGCCGTCTGAGCCTCCGCGCATTAGATACTCGGCAGTATCCCGAAGGCCCTGAA
GACACCCTGTCAGCACGCTTTTCAGGCGATATGGGATTGCAGTGACAAGCGACGCCAGCGCGACAGCAGCCTGAAAACGAACACTTTGCTTTTCGTGACA
AATCAGGTCCTGGAATACGTCGCTAGCACCACGTGCATGGCTCACAGAAGCCTCCCCCATCGAGTGAAAGAGATGACTCAGCTCCACTAACGCAGCCAGA
ATCTTGTGGTGGTTTGACTCTGCTGCCTGCGCCTCAACTTTTAGTTTCTGCAGGTAGGCACCCAGCAGCACCTCTTGCTGGCGCTCGGTGAGGCATCCGT
TGAGCCCATAACGCAAAACGAATCCCACGGAGTTGCGCGCTCGAGTCAAATCACCGAGAGCGAAAGGATGGTCAAGGATAGCAAGGATCGCATCCAGGAC
TTCACGAAGCTGCGACTCAGCGATCGAGTCGGGTGGCAAGCGCTCAAACATACTGCACAGCGCGATCGAGAATGAGGCGAGGATGCCTCCATGACTTTGG
TTCGGGTTAGTGGACAAATACTTGCTGGTCACCATGTCCTTAAAGTAAAGAACCACGTTCGCGATGGTCGAGAAGTTCACCGTGGCTGCTTTTCGGCGAG
AAAGCGACGCCGGCAGGTTAATCCCAGGAACGTGCAGTTTGAAGCCTGTCTTGGCCTTCCCGCTGCCGCTGGATGGCGGTGTGTCGTGTTCATTGGACGA
CCGCCCAGCTGCATCCTCCTCGTTCGCGCCATTGTTATCCCCCGCCTGGATCTCAGCTTCCCCCGACGACGACGTCGCGTACTTGGCAAGCACCGTGCCA
ACCACTGTCGAGTACGCCCTCCTCGCTTCAGGAGCGACGTCGTCCATGCCCTTCGCTGTAATCTGCAAAATTGCATCCAATGAAACACCCTGCGCGCCGG
CGTGGCTGCCGCCTCCACTACCTGCTCCGGCAGCGGATCCGCTGGCACTAGCAGCAGCTCCTCCACTTCCATTCCCACTACCACTGCCGCTCCCTTGAGC
TCCTCCAGCTCCTCCAGCTCCTGCACCTGCCGACGCCGCCGTGGACGCCGACGTCCGCTCTGCCACCACCTGCAGCAGCCTCGCGGCGGCGATGCGCACC
TCGGGCGCCTTGTCCTGGAAGCTCTTGTTGACGATCTTGAGCGCCTCGGCGTGGAACGGCACCAGCCGTCTCGAGTCCGCCTCCAGCGCGTGGGCCACGC
TCTCGATCAGGCACTGCTTCATGTAGTAGTCGGCCGCGCGCAGGCTCTTGTTGGCCAGCGCCACGGCGTCGGGCAGGAACTGCAGCGCCTCCTGCAGCGG
CAGGCGGCACACCACCATGAGCAGCGACGCCTTGACGTACAGCGACGAGTTCTTGGCCGCCAGCGCGTCGTTGACGCTGGGCACGACCGAGAAGTCGAAG
GCGCGCACGAGCAGGTCGCACACCAGGCGGTGCACGCACTCGGACGTGGCGGCGCTGGGCGCGGACAGCGACACGGCGCCGCCTCCTGCCGCGCCAGCGC
TTGAGTTGCCCGTGTGGCCGCCGCTGTACACGATGAGCGTGGCCAGCAGCAGCTGGAACAGCGCCGCGTTGCTCTTGGCGCTGCGCTTCTTGCTCGCGCC
GGGCGCCGCCAGCAGCTCCGGCTTCCACAGACGCTGCAGCGCGATCAGCGCCTGCACCAGCTCCTGCTGCTGCTTGTGCTGCTCCAAGGCGGAGCCCCCG
CCGGCGCGCAGGGCCTCCACGGCGGCCGCCAGCCTCCGCGCCGCGCCCTTCATCTGTCTTCGGTAACGGTATCTGACGTCGGGAGGGGGAATTGCGTCCC
CGGGGGTAGAATTCGGGCGGGAGGGGATACAAAAGAGTGAAGAGAAGACCAAGATGATGCAGCAGACGACGACGACTCGGTCGTGGGAGGACCTGCGCAG
CAGCGCACGCGCCGCCGAGCGCACGCTGGAGGACAAGATCTCGGCGTACACGGCCGTCAGCAGAGCGCAGGTGCGCGGCTCCGCGGCGGCGTATGATGAA
GGTGCGCGTGGGAGGAGGAAGAGGGGCTGGAAGAGGGTGTGGCGGCTGACTGGGGCGCTCTGACGCTGCAGAGAACCCGCCGGAGGAGACGGCGGACGAG
AGGGAGCTGGCGGTGGATATTGAGAACGCGCTGGCGGCGGTGCGTGGCGGTGGAGAAGGGAGGAGAGGCTGCCAGGTTGTGGGAACTCACTGTTGTTGTT
GTGCTTGGCCTTGTTGTGCTGCGTTGTGTGTCTGTGCGCTCAGCTGTCGGACACCATCGACGAGATGAACGTGGTGGTGAACAGGACGTCGGTGAAGACG
CAGGACGCCATGCTGCAGCGCTACAGAGAGCTCTATTTCGACTTGAACACGGAGTTCCGTCGCTCGATGGTAGGGCCTCCTTCTTGCTGGCGGAGAAGGT
ATCCAGAAGGGTTGTTGATGCAGTTGGGCTGTGTTTTCGTGTGTGTGTGTGTGTTTGGTTGCTGAGTAGAGCGCACTGCAGGAGAAGCGCGACGCACAGA
AGCTCTTTGGCAACAGGTGCGCTTGGATTTATTTTTTTGAGTTTATCTCCCAGTTCTCTGCATCAATTGGTGGTGCTGAACAGTATCTAACCGTTCTTTT
GGGTTTTGATGGCTGGACCTGTTTGTACTGGAGTAGAGCGCACAACGGCCACTCGGACGACGCAGAGATGGACTCGCTGCTGAACGAGCGCCGCGCCGTG
GACTCGTCGCGATCCATGACCAGTAGCATCATCGAGCAGGCAATGGCGACCAAGAACGCACTGGAGAACCAGCGCCGGCAGTTCACGTCGTCGCACGGCA
AGGTGGCGACGCTGGGCAGCTCGTTCGCCGGCATCAACACGCTCGTGGAGCAGATCCGGCGCAAGAAGATGCGCAACAACACCATTCTGGCGCTGGTGAT
CGCCGGCTGCGTCTGCTTCACGCTCTGGTGGGTCGTGCTGTCTAAAATCTAATGCTATTTGTCAGGGAGCGGCCGTGCAGCCACACCCTAAGTAATACAC
AAGCTCCATACAGGTCATTCTGCAAATACTGCTGCTATTGCATCACTGCTGCACACGTCACATTTGGCACCGGAAATTAAAGTTTTTACCCACCAATCAT
CTGCGGCCACATCGTCGATAACGCCGCCCATTGGTCAAAACAGCGTCCGGGATTTGCCTTCTAAAATGGTTGGCGTCCTTTGTGTACGGGGGCTTCACAC
TGAAAACGACCGAGCCAAGAGGCAGAGCAACCACTACGAGCATGGGCGACCGCGGAGGAATCTCGCTGCTGGTGCGCAACATCAGCCGCCGTCTGAGGTG
CGTGAGCTTGTCTGTCTGCTGCTCTCTGCTCCGCCTTGCTGCTCTCCGCTCGAGGCGCAACGAGCTATAATAGAAAGTGACTAACCTCTGCCACGTGCCG
GAGCTGCAGACCCGAAGACATCCGCAAGGAGTTCGAGCGCTACGGCGAGGTGCGCGACGTCTACATCCCCAAGGACTACTACACCAAGTACGTGGCCCGC
TGGAGCATTGGGACTAGGGCGTTGCAGCTGACAGAGAGGCGCTGCTTGCTGTTGACAGGGAGCCCAAGGGCTTTGCGTTCGTCGAGTTCCGCAGCGAGCG
CGAGGCCGACGACGCCCGCCGCAACTTGGACGGCGTGCGCATCGACGGCCGCGACATCCGCGTGGTGTTCGCCCAGGAGCGCCGCAAGTCGACGGAGCAG
ATGCGCGAGCGCGAGAAGTGCGGCTCCACTGTTCACGTTTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCTCGCGTTG
ATCTCCTGTCTGCTTCCCAACTCGCATGCGATTGTTTGCGTGCCCCTCTACCCGAAGTTGCAGGTGCAAGCGCAAGAGCAGAAGTTGTGAAGATGGTGAA
GACTCAAGCACAAAGATACAAACGCAAATAAAAACAAAGAAGACTGGGTACTACAACTACTTGTCCAAGAGGGAAGGCAGAGAGGAAGGTTTTAAAGCAA
GCTGCGACCCCAGCCAGATGAGCTTCGTAGCGTCGGTCGGGTGTCAAGGTGGTCTAGAGTCGTGCGTGTCCTGTCCAGGCGTGTTTTGCTCGGTGTTGTG
TCATGATCAAGCAAAAAGGGAAGCACAGGCATTTCGTCTACATATTCCTTCGTCTACCATCAATCGCTCGGTGCAAGATCGCCACATTATCTGGCGAGG