Description :
From Genome Similarity Track
Location :
Scaffold_1004:2112- 4368
Transcript NameFunction/comments
Phyke_g11413hypothetical protein

Sequence
2256 bases(100 bases per row)
AATGATGAGGGAGTCTAACACTCGCCAAGGACTGGTCGCGATCAACGCTCGCACGTTAGCCTCGGTAATCAACTCGGGATTCCACGAAGATCGGCGAGGT
GTACGAGTTTTTTTTGGGAATAACCAGAACATCGGGAAACTCAGCTCGTGAAACAGTGTGTCGAGCGTCAACCCTCGAACACTAGTCCGCGAAATAGCTG
ATGATGGACATGGTGGCTGAGAAGACCTTTGTCGAACGATAGCCGGGAATCCATTGATCACGAGGAACAACCGTCGGATCGAGACGACCCAATGTCGTGT
CAGAAAGAACAGAGTTACCTGAATCTtcactgctggaactgctgttgtcatcatggctgctgccgccaccagGGCTAAGAGGTTGGGGGATCGAAGAGAC
GCTCGATCCAGAAACCGAACGTTGGTGACGAGAAGGAGTGGCCGATCCAAAGGCATGCCGTCCGCTGAGTTGACTGCAAGGCGATCCACTATCGCCATCT
GAACTTGAACTGGATGAGTCGAGGTTGATCGGACGAATTGGTGTTCCGACCGAAGTGCGACTGGTCTGACTGGATGGGAGACTAGATCGACGTGCGGCAG
AACGTGTTTGCGAGAGCGTGGCCAACACAGTATCATcactggacgaagacgaaggttGAGCGACAGGAGAAGgatatcgtcgtcgtctgcgtaAACGCCG
ATGAGACGATGGCGAACGGCTAGGGGGCGATCGACCACGAGAACGTTTGTGAGATGTGGAGGATCGTGTCGACTGCGGTGATGCCGATCCAATTGGAGCC
TGTGGAGTATGTGGTGTCGACGGAGTTGAGGGGGTTACAGCCGAAGCAGTAGAACTTGGGTGGATCAGCGAAGTGATCCCTGCAAGATGGGTCTGGATGT
CGGTTCTCTCAGCTGTCAGTCGATCACGATCAGCTTCGAGATCAGCCTGAGCAGCTAGAGCGGTATCTAAGCTCGCCTGCAGAATAGCATTCTGGCTCTG
CAACTGTTGCGAAGAGACATGCTCGGACTGCAGGACACTAACCCGTTTCTCGAGACGAGCGATCGCTGAACGAGCAGCGCCGATCTGATCTCCTATCATA
GCCACAATTGTAATGTTAGTGGCAGATTTGGGAAAGAAAGGAAGCACAAGCAGACACGTACGCATTGATTTGGACTCTGCAGTAGCTCGATCGCGATCCT
GCATCATCCGTTGAAGATCTGCGGCAGCTGTTTTGAGTTGGACTTCGGACCGATCGACGCGTGACTGGAGATCATCACGTTCCGCGAGGCTCCGGTCCAG
AGTACGACGAGAGCTAGTTGTCTGTTTATCCAGTTGGGTACGGAGGTCTGTAGATCGACGAGTCAAAGCAGCAATCTGTTGGCGTAACTGTGCAGTTGCA
TCCTCGAGGGCCTTCTGTGAAATTTCTGAAGCACGGACAGTATCTTGAGCTTGGTTAACTCTCAGGATAGCAGCGTCTCGATCAACAATAGCGGAGTCGC
GATCTGCCTGCAACTGTATCAGCTGTGGAGCTAAACTTGACGTGGCTGCGGGATGCGCGACAGCTACTTGCATTTCGAGCTCATCAATGCGCTGTTGGAA
GTCAGAGACCGCATCGTTGTGTATTTGATTCTGGTAACGAAGTCGATCGCGGATGTCCTCGATCTCTCGAGAGTTATCCAAACGATCTGCTAGAGCTGAT
TTAGTGTCGGCCAGCCGGATGCGAGTGTCTTGGAGTTGTTGTTGCGACTGATCGTACTGTTGCTGACAAAATTGCACGAAtggcgatgcagcattggctG
CATCGGCTAGTTGCTGTTCCAGATCGGCCGCCCGCCGGTGAAGTGCAAGATATGCTTGCTGGAGATCAGCATGGTTACGTTGGAGATCTTGGAAAGCATC
TTCACGAGCTAAAGCTATCTCGATCGCTGCCAGAGAGGAATGAATTGATCCGCGGGGTAACTCGGGAACTATGATGTCCGCTGTAGACACAGTTATCGAA
CTGAATGCAGAAGAAGGTGTCACACGGAGCCAATCGGCAGTACCCGGGGCGACTGGAGGAACAACACGACGTGTCGCTTGATCGCctggtgtgcttggtg
ttggGAGTGATCTGGAAGCAGCCGCAGAAGTTGCCGACGAAGTTGGGCCTGACAACGATGGAGTGTTAGAAGCCATGAGACGGAAAGACCAGGTAGTGTG
TTCAGAGCGGAGCAAGTCGAAGAATGTGCACGAGAGTCAACCGTTGTGCGGCCGGT