Description :
From Genome Similarity Track
Location :
Scaffold_108:21117- 24861
Sequence
3744 bases(100 bases per row)
GTACCTAAAGTTCCTTTGAACTTAGTTATAAAGATTTTGGACTTTGATAGCATTGAACGCTGTCTTGTCCTTGATCTGGACTCGAGATATGATCTCATCC
TAGGTATGGCTTGGCTTGAACGCCATGAGCCATGGATTGATTGGAGGTCGTAGACCTTAGGCGCTACGCGCAATGTTACTAGCGAAGCTTTGGAGAGTCA
TGAACCCACCTTTGCTAGGCAACAAAAGCATTATTGGCGCGAGCCTTTGAAAGAAGATGTCAATGTGCTGGACATTGGAATGTCTGAGTCAACTAACTCT
AATGTTGAAAACATGAATTCCGAGCGTAGCTCGTTGAATATTGGTGATACGGCACGTACTCCGTTGAGTGTTACTCGTTGTGATAACGAGTCATTGCATG
CTGAAAGCATGGTTAGCCTAGGGCCGAGTTTTCAAGGATGTGATTCCTTTGATGTTCGTGGGGTGACACGTAAAAATTCACCGAGTGCGGTCGGCCGTGA
AGGCACCACACTTGATGTCGGTAATGACATTAGCTCTCGTATAGAGCGTACTACTATTATTAGTAACCACGGGGACACTATTGTCCCGACCCCAGAGGGG
TGTAAGATCTCATCGAATAGAAGACCTGGACGCCAGGTGGCAACTGTTAAGAGCCAGGCGTCCGTGCAGTCACATAGTGACAATAGTGATACACTATATA
CACTTGTCAACGGAGTGACTGGCCAGGTTGAGGGCAATGTTAACCAGGAACCCCTTCCATCTTTGGATCCTCTTTGTGAGCTAGACGAAATGTCTGATGG
CGAATTTATCCAGGCCTTAAAGGCAGGAGATTTATCTGAATTAGTGGTCATTAGACCCGATGTTGAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTC
CTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGACATCTTGAAATTCCTTTACCAAAGGATAGAAGGGATCCTTAAAGATCCTTTGGATCCCTTCTAT
CCTTTGGTAAAGGAATTTCAAGATGTGGTGTGTCACAATCCACCTTCTATCTTACCTCCCGATAGAGGTGTACGTCATGAAGTTGACCTAGTTCCAGTAA
CTAAATACTGCGTAACACGGCAGTGGCATTTACCTAAGGAACAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGA
GAGTAAGTCTCCCCATTCCACACCTACTTTCTGTGTCAAAAAGCCTAGTGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCTGCCACTATT
CCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAGTATGGTGGTATGTACATTGTACAGTGCGCTCGACTTTGTCGACGGTTATTATCAGC
TGCTCATGCGAGCAAGCGATATTCCGCTGACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGACTGGCTCGTTATGCCACAAGGGCTGTCAAATTCCCC
GGCTACTTTTAATCGTTTGGTGACGCAACTATTCAGACCTCACCGAGGCTATGCACAAACGTACTTTGATGAAATCTTTGTGCATAGTCGTGCAACGAAC
GGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGCACGAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTG
GTGCAGAAGAGATTTCCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCATCGAGCGGACCCCGCCAAGATAAGAGCTATAGTCGATTGGCCGGTTCCAAG
AACCAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTACAGTGAGAATTATGCAGATATGGCTCGTCCAGTATCCAATCTCCTTA
AGAAGGATGTGGATTGGTGTTGGGGTGACACCGAACATGAGGCTTTCCAAGCAGTTAAGGAAAGTCTCCTTCATGCGCCAATACTGCCTTTGCCCGATCC
TGGTCGGCCTTTCAGTGTCGTCTTTGACGCATCTGACTTTGCCATAGTCAGTGCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGTCATTGCATTC
GAATCTCGACAGCTCAAAGCTGCTGAAAGGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTTGTCAAATTCAGAGTACATCTGT
TTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGACACCGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGCTCTCATT
CTTTGCCGAATATAACTTCGAGGTGAAGTATAAGCCAGGAGAGCAAAATGCTTTGGCTGATGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTC
ACTACGCTGTCATCTTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGGAGTTTA
AAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGTCCTGTTGTGCTATCGCATAGATATTGAGAATAA
CCCTCGTATCGATGTCCCTCATGATGAGGAGTTGAAGTATCGAATACTCTATGAGGCACATGATACCGCTTCTAGTAGTCATCTCGGTCGTGAGAAGACC
TATAGCTCAGTGAACCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTTAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGTGAAACCCTCAG
CACATGCGGCGGCGCCGCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGC
CAACACTGGCATTGTGGTCTTTGTTGACTGATTGAGCAAGATGGCTCACCTAGAGGCTGTGCCGGACTCTATTGATGCCGAAGGCACAGAGAAGCTGTTT
ATCGACCGTGTATTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTCACTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGC
TTGGCACCCGTATGGACATGTCCACAGCGGATCATCGGCAGACCAATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGTGCAGTGTTTG
CGCTGACACACCTATGCGTTGGAGCTCCATGCTCCCTGATGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCGACAGGCTATACTCCGTTCTACGTA
AACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTGGTTCAGGGCTTGGTGAGGGAGAGGTTGCCGATCAGCTTGCTGATATCAGCCCTG
CTACTGTTCAAAAACAGGTAGGCGAGTTTTTCGCAAACGCGATTAAATGTCTTAAGACATGTGCGTGACGCAATTGCTGAAAGCCAAGATCAACAAAAAC
AACAAGCAGATGCTAAAAACAGAGGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATACTAAAAACCTACCTACAAATGTAGTGTCCGC
TGTCTTCAAAACAAAGTTGCGTCCGTGCTTCATTGGAACATTCACGGTCACTGCCAAGAAGGGAGTTGCGTATACGCTCAACCTTCCACGCAAATTGTGC
ACACATCCGGTGTTTTACTTGGGCTTGCTTAAGCCGTATCGGGA