Description :
From Genome Similarity Track
Location :
Scaffold_33:2111- 3178
Sequence
1067 bases(100 bases per row)
CAAATACACTCATTAACGACCTTGCGATATATGCACGGACACATCAAATAGCACGCCGAGCGGATAAGTAGGCAGAGAAAGTACTCCATCTAATGTACAC
GAACAATTATTCAAATCAAGTCTAAGCAACACTACGATCTGATACTCTGCATACAGCCATATATCTTCGTATGTTTGTCGTACATATCGGACCCAGTATA
ATGTCAGTCGGAAAGGATTTACGCCACTTTGTCAGTCAGTAGCTATGCCAATAAGTCAGAAAGTACGTCAGCTATGCAAGTAAGATAAATTCATGCGGAA
GATAGTGGAAATACCCTTCAGTAACATCACAAACAGCTCAGCAGAATAATTTCAAAGCATAATATTGATGTTTGTGGCGACCATCGGCAAAAACTACCTA
TCCTAAAAGATACTTCGCGCGAGGAGCTGATTAACATTGCTCTATTAGACCGTCGCAATCGATGATATGTGTCGACTGCCTCACGGCGATGACGTGCAGA
TGGGTAATATGTTTGAGTAGGCGTTTTTACTCCAGCTACACTGGGATTCCTCACCGATCTACGCATATTTCGTAGCATCATTGATACTGACCCGTCTTCC
GTACAGCATATATTAGCTTTGCAACCACGCGCGCCTCCGATTCGTGACATTTTGGGAGCTATGCGCTCAAATGAGATTATAGACAAAACCCTCCCGGCTA
AGATGGTGCTCATCTTGCAGATCACGATAAACCCTGGTCATGTCTACCATAACATGTGAGCACTATAGATACTGTGTGCGGTGTTGTTTTGGAGCGTAGC
ATAAGTAGATCACAGCATACTTATATTATATGTAGCTGTGGTCCAAGTAGAAATTCTAAGCCCACCGCAGCGCAGCGGAGGTGGTCCGCCCTCTCTACAC
CAACCAACCATGCCCTAGCGTCCGCGGAGCGGGGCGCCCAGAGCGCTAGTTTCCCGCTCCCTAACCCTTGTAACCCTGTCCCGTCCGTCTGTCTGTCAGC
CGGTATACTCTCATTCGTTCATTATTTCCTGCCTTTTGCGTGGGAAAAAATCGGTCATGCAAACAGA