Description :
From Genome Similarity Track
Location :
Scaffold_82:211015- 213115
Transcript NameFunction/comments
Aphas_H257_15620Hypothetical protein

Sequence
2100 bases(100 bases per row)
TGGTGTGAACCAACAGACAAAACCGCGGTCGAACGGTTCCACGAAGCTGTCAAGGACCTCAAGGTGCAGAGGGAGGCCAGCCACGACCACATGCTGCGAG
GGATAGAGCCTGTGCAGGCCACGAGCAGCGAACGACGCGAGTGGATGACGCTCATGTGTTCGAATCCGCCATTGAAAGAGTGGTGCGCTCGGCTCGTGGC
CATATGTGATGGCATGACCCAGTTAAAGCTCACGGAACTGCTCATGGAACTTCCGTCAAAACGGCATGCGATCGCTTATGTGCGAGGGTTTCATAATGAC
ATTATGGGGGCAGTTGATCGAGACGCGTTGGTGGCCGACTTGATGGGGCACTTTCGCGTCCTTCGTGGGGTGGAGCCTCTCGCCGATGCATTGATCCACA
TGGCTACGACCGACATGGAAACGACTTGGCGCGACGATATACTCTATCGCATGAACGCCCAAGAAGCGTTCCTGGTCGATTATGTCCACAAAAGTCATAT
AAAGCACGCAGGCCAAGCCGCGCGGGATGCCAGACAACGGGGCCGCGGAAACACTGACGCCAAGCTCAACATGGACACGCAGCGAAGTATGGCGGTGGAC
GCGAAAGCAAGACTTGACGACGCCATGGTCAAGTGGAAAGACGCCGAGTTTTCCTATGCCCAAGCCCAACGACGCATGCAACTGGTGCGGGACTCTGCCG
TGACACTAGTCGACCGCCGCGATCGAATGCTCTGGGCTGAGCGACTCAAGCGAGCTCTGGAGACAACGGACAAGGGCGCGCACACGTACATTGAAGTGGT
TCACGTGTGTCAAGACTTTGTCGAAGTCGCCCGCCATGTCGCCACTCAAATCGTCCGCGAATACTACCTCCCCGTCCATGAAAAGACTGTGATGCCGGTG
GCAGGTCCGTTTCTTATGGACGGCCGCAACGACGGCGCCGTTCGATCGAGTCACGGCAAGGGGCTCAAGTTTGAAGCACACAACATTCGATTCCAAGTCG
CATTGGACGACCACGACCGATTTGACCATTCAGACGAGCTGGCCGCCAAGTTTGCGGGCGCAGAGTGCCGCAACTCGAGCTTGTTTCTGCCGACGATGCT
GCTGACACCAAACGTACTCGTGCCCCTGCAGTGCTGCGTCGACTACCATGGCATGCGGGTGCTGTGTGTGTCCAAGCTCCCGATAGAGTGCTACGACGTG
AGTGACAAGGGTGTGGTGCAGAACGTGCGCACGGAATTCGTATATGGCACGAACAACAAGGGGAAAACCATTGTGAGTCACAGCAAGACCCTGGACGCAT
CGATAGCCAAGGTCGGTGTTGGGTTTATATTTCCTTGGTCACATTACAAGTTGGTTGTGTGGATGCAGACATACTGAATGATGATGATGCTGTAGGTGAA
CGCGAGCTTAAACTTGGGCGCGCATTGCGTCCGTGGGTCGTTGGACTTGACGGCCAAGTTGATCCACGGAGCCGGCGACATGCACGGATACATCGGACAA
GGCGAAACGTTTTGCTTGCTCAAGTTCCGACGCATGATGCCGCCAGAAGACCCCGAGGAAACCCCCCACTTGCCGGCGTCCACTCGGGGCATGAGCATCC
TCTGGAGGCAGCTCCGACCGGCGCTGGTCAAGACACATCCCGTGCCGCTGTCACCGGATGCCTTGTCGTTGTTGACATATCAAACGCCGGATTGGGAAAA
CCAAGCCGCGAGAGTTAAAGACTGCACGAGACGCATGCTAGACGACGTCCTGCCATTGTTTGCAAGGAAGCTGGCCGAGAGGGAGGTATGCATGTATATA
CACAAAATCCACTATCGAATCTCCATCACACTCTGTCACATACGACCTGGGTCAGGACTATGTGACGTCACCGACGTTTTCGCTTGTCGGGGAACTCCAC
CGCCATGGCATCAACGTGCGGCATCTGGGGCTGCTGCGGTCGTTGTTTTACTTTCAACTTGACGGGGCAGTCGCGTTGGCATTCAACCAAGCTGTACTGT
GTCCGACTGTGGATTTAACAAGGGAGTTGACACGAGGAGATACAATCTACATTCAAGGCCAGCGGTTCAAAGTACTTAGAACAAACCCACATATATATAT