Description :
From Genome Similarity Track
Location :
Scaffold_57:2110- 3639
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014043Similar to CBP31: Serine carboxypeptidase-like (Oryza sativa subsp. japonica)

Sequence
1529 bases(100 bases per row)
ACGCGCAAGGGCGAGAAGACGCCGCTGATCCCTGTCTACGGTAGCAGCGGCGCGCAGAACGCGGCGGAAAGCAAGAGACGCGCGTTCACTAAGCAACAGC
AGCGCGCGCTGCTCGTCGTCGTCTCGGCGGTCGCACTCTTGCTCACGTTCGGCATCGTCACGAAGGAGAACAGCAGTAAACTGTTTAATGCGCCATCTTC
TGCTTCTACAGACGCTGTGTTGAAGAAGGCGGTGCGTGCGGACAAGGAGAGTGGTGCTGTCGAGGAGGAGGACTTCTTTTGTGGCTTTGCGAATCATGAA
ACCGGGTACATCAAGCTGCCGAACAAGAAGGACGACCACTACTTTTACTGGTACGTGGAGTCGAGAAGCAGCCCATCGAAGGACCCACTCGTGCTGTGGC
TCACGGGTGGACCAGGGTGCTCGAGTATGATGGCGCTCCTCGCCGAGAACGGACCCTGCCACGTGCAACCCGACCTGTCGACCAAGATCAACCCGTACTC
GTGGAACCGCGAGGCAAACGTGATCTGGCTGGACCAGCCAACGGGAGTCGGCTACTCGTACGGCGATGAATCCGATTACGACTCTGGGGAGTTGAACGTC
GGCGAGAACATTTACTGGTTCCTGCAGGAGTTCCTGAAGAAACACCCAGAGCTCGCCGATCGCGAGTTCTTTGTCACGGGTGAGAGCTATGGCGGCCACT
ACGTGCCTGCTGCGGCGAGCTACATTATCAAGCAGAACGTCCATCGCCATCTCCACCCCGAAGCAGTCCACATCAACCTGGCGGGTATCGCGGTCGGAAA
CGGTATCACGGATCCTATTGTGCAGTACCAGTACAGCGTGGACATGGCGTTCAACTCGTACAACGTCACGTTGCTCGATGACGCGCAAATCGAAAAGATG
CGCGCTGCGCAACCCGTGTGCCACGCGCTCACGTTGGCGTGTCAATCGAACGCGACTGCGTGCCTCGATGCGTTGGAGTTTTGCTCCGAGACGCTCGAGA
CGCCATATTTCCTCGCGAAGCGCAACCCGTACGATATTCGCCAAGCGTGTGACGAAGAGGACTTGATGAAGTGTTTCCACTTTGAGCACATTGACGCGTA
CTTGAACTCGGAGAGCGTGTTGATGCAGTTGGGCGTGAACACGAAGCATTCCAAGGCGTGGAGAGAATGCGATGGGCATGTCGGCTCGGCGTTCGTGTAC
GACCAGATGCGCTCGTTCGCCGACGACGTCAAGCTCGCGCTTCACTCTGGTGTTCGCGTGTTGATCTACGCTGGCGATGCCGATCTGATGTGCAACTGGG
TGGGCAACCAGGCGTGGACGCTTGCTTTGGACTGGAGCGGCAAGCAGCAGTTCAACGATGCGGAAAACCGCGTGTTTGTGACGTCGGAGGTCGCCGACGC
TGGTCGCGTGCGCTCGTTCGAGAACTTTGCGTTCGTGCGCGTGTTCAACTCGGGCCATATGGTGCCAATGGACCAACCGGCCGTGTCGTTTGAGATGATC
AACAAGTTTTTCCACGACCAAGACCTCTA