Description :
From Genome Similarity Track
Location :
Scaffold_3437:211- 2545
Sequence
2334 bases(100 bases per row)
TCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAG
CAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCC
CGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTAC
CCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCT
GGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACA
AGAACTCCATGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTATGACAAGTCGTGAAG
TCCTTAAGGGAATGCGGTGTTGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTTTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGAT
GCCCCTAGAAGTGTGGCCGCCCACAAGGCACGAGGAGCGACGAGAAGCGCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTG
AGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAGCCCCCACGCACACGCTGGGCAGCTTAGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGA
GACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTACGATTGGAGCGTCGA
GTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTAGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGG
CAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGTCCTTAGCCTTGACGGCCGGACACTCAGAGCGCACAGAGGTCCT
AGGACTGTGATCACCTTGATCACTAGCGGGCGACTGCACGCTAGTGATCGCTGTCATCTTTGTGCTCACTGGGCATCGGGCTGTGCCCTCCCACAGAGTC
CGCAGGAGCATCGTGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCATGTTCCACGAACCGAGGGCTCGGACGATTGTCTGAAGAT
GAGGGCGACGGGCTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTTACCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCT
TTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGG
TCGAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATAATTAT
CAACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTT
AGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGC
CAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTAATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTAC
CTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGC
AAGGTGCTGTGTGACCCCGTCACTTTTTTGTAAAAGGGACGCACTCCTTCAGCTCGCCCCTCGCTTGCTTTCATGAGAGAAAACGCGAGCGAGAAAACAA
CAAAAGTTGGCCAGGAAGACCGTTGGTCAAAGCTGCTGTTTCTACTTAATTCAGGAAGAGCAATACAGTGTCAAAACGCAACATTGATTGAAACAGCTTC
GTTGCAGACCGCGCAAGCATGCTCAGCTGTTTAT