Description :
From Genome Similarity Track
Location :
Scaffold_4068:211- 1418
Sequence
1207 bases(100 bases per row)
CTGCATCGATACTCACTCGATCGCGGTCCTGCTGTACTACAGCACCGACTCTGGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGAATCTAAAGTA
TCGAATCCTCTACGACGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATG
TATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAGAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCA
AGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGCTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGTATAGTGGTCTTTGTAGACCGATTGAGCAA
GATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCA
ATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTTAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGC
AGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCGAATGCGCCAAAACGCTGGGGCCAGATGCTCCCACT
CGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGTGTCCCACTGACGCCGCCA
CGCAGTGGCTCATGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGACGCCTTTGTCTCTTTGA
GATGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAAAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGAGGTTT
GAGGTCGGAGACCAAGTTTTATTAAACGCTAATACCCTACCTACTCATGCAGTGTCTGCAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATAGGACCGT
TTAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGTACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGCCATATCA
AGACCCT