Description :
From Genome Similarity Track
Location :
Scaffold_32:210977- 212137
Transcript NameFunction/comments
Phyci_221793hypothetical protein

Sequence
1160 bases(100 bases per row)
AGGATCGACACATCGAAGGTACCGCCACCCAGGTCGAAGATCAGCACGTTGCAGGCCTTGCCGTCCGTGCCGGCGTTGGTGTCGAGGCCGTAGGCCAGGG
CAGCGGCCGTGGGCTCGTTGATGATACGCTTGACGTCGAGGCCAGCGATGGAGCCGGCATCCTTGGTGGACTGACGCTGCTGGTCGTTGAAGTAGGCGGG
CACGGTGACCACAGCCTGGCTGATGCTCTGGCCCAGGAAGGCCTCGGCGGTCTCCTTCATGCGCAGCAGCACCATGGACGAGATCTCCTCAGGGGTGAAG
CTCTTGTTCTCGCCCTTGAACTCGACCTCGATGAGCACCTTGTCGTCGTCGCCCTCCTTGATCTTGAAGGGGAAGTGCGTGGCGTCCTTCTTGACCACCT
CGTCGCTGAAGCTGCGGCCGATGATGCGCTTGGCGTCGAAGACCGTGTTGGTGGCGTTGCCGGCGGCCTGGATCTTGGCGGCCTCGCCGATCAGGCGCTC
GCTCTCGTTGAAGGCGACCCACGAGGGCGTCGTGCGGTTGCCCTCGCTGTTGGCGATGATCTCGACCTGGCCGTCCTTCCACACGCCGACGCACGAGTAG
GTCGTGCCCAGGTCAATGCCGATGACCTCCGAGAAGCCCTTCTCGGCGCGCTTGGCGCGCTCCTCGCGCTCCTTGCGGGCCTTGTTGATCTTCTCCTCGA
TCTCCATGCGCTTCATCTTGCGCGTGGCCTCGTCCATCTCGACGCCGCTGATCTCCTCGTCCTGCACCTGCTGGGCGGCCTGGGCCTGGGTCAGGCCGGC
CTGCAGGGCCTTGTTGCCCTTCTCCACGGTCAGGCCCTGCGTGTAGGCAGTGATGGCCTTGGCGTAGTTCTTGATGTAGAAGTGGGCGGCGCCCAGACGC
GCGTAGCCCTTGGCGAACTTGGCGTCCAGGTCGATGCACGTCTTGGCGTCCTGCATGGCCGGCGTGGCCTGGCCGGCCGACAGGTAGGCGGCCGAGCGGT
TCGAGTAGTAGATCACGTTCGACGGCTCGTACGCGATGGCCGTCGTGAACTCCTTGATGGCCGTGGCGTGGTCGCCCGAGGCGAAGGCGGCGTTGCCGCG
CTCCTTGGCCTCCGCGCCGAGCTTGGCGCGCTCCTCGGGGGCGACGCCGGCGTACACGTC