Description :
From Genome Similarity Track
Location :
Scaffold_389:2109- 3640
Transcript NameFunction/comments
Phyke_g9100Major Facilitator Superfamily (MFS)

Sequence
1531 bases(100 bases per row)
GCATCACACATAATGTGTGGACGGCTTATATcttcacgctcttcttctggtcgGCACGAAGGTAAACTAAACAAACAAATATAAATATATATCATTCATT
GAGAACTTATTGGTGTACAATAGTATTTTGTTCCAGCAGGTGGTTGCAGGATACGTTTTCGTCTTGACCCAATCCAATAAACCCGTGGGTATTGTCAAGG
GTATTCAAGGTATCTCACAATTGGTTTTCTCCCTCCCGGGCGGCTATTTCGCGGATCACACGCGTCGGGACACCATCCTGAAGTTTTCGGGAATTATTGG
CATTATTGGTGCAATCATCACCTTTATTTCGGTCGAATTGACGTCGCTCAATGGTCTTTACGTGGCTTTTGGGCTCTGGGGACTATTTGCTGCTTTCCAG
AGTCCTGCTATGGAGGCACTATTTGCCGACTCCATTCCTCCTGGGAGACGCTCCTTCCCGTTCATGATCAAGTACAACATTAGCAATTTGGCACAAATGT
TGGGACCATTGCTCAGTATTTTACTGTTTTTATTTTACGGAGACCAATGGCAATTGCCCGAACTCAAACCTGTGCTGGAGTTTGGGTGTGTCTTGGGAGT
GGTCGGTTCCTTGATTTTGTTCCAGTTTAATGATGACCGAGCCAAGGACTATATTGTGGATAAGAATACGCAggaaaaagagcaagaagaatTACTTGAA
AAGATGGTCACTCCATCACCAATCCGTACCCCGAGATTGGTCGGGAACGGGAATGAGATTGACATGGTGTACGACTACCCGGACGAAGACGATATCACTG
TGGATGATAAATCCCCGCCGACAGTGACCGAAAATACGGCATTATTGTTGTTGAAGGGCAAGACCGCCCAGGAGATGGACTTggaacgacagcagcgtct
ACTGGAAAttgaagacgaggaggaggggTACATGGCCCACCTCGACGCCAAATTCCTTTGCTTCCGGACCAAACACGTGCCGTACCTTTTGTTCATATCG
GACTTTGTGATCAGCAATGGCGCCGGAATGACTATCAATTTCTTCCCATTATTTTTTAAAGAGGAGTACGGACTCACGCCGATTCACGTCTGCGCACTCT
TCATGAGTCAGCCACTCGTCGTCATGATTTTGTCATTCCTGGCGCAGTGTCTGTCCAAGTCGTGCGGTCGTATGCCGATCATCGCATTCACCCGTACATT
TTCGGTGGTATGCTTGTTCTCGATGGCGTATGCACAGCCGATGGTACTGCAAATTGTGCTGTTCCTCATGCGTGGCGGTATGATGCGTTGCTCGCAACCG
CTACGTCGCTCGATCCTCATGGACTACGTGCCCAAGAACATCCGTGCGCGCTGGAATGCGTTGGAAGGGTTGTCGGTATTCTCCTGGTCGGGAAGTGCTG
TCCTGGGAGGGTTCTTGATCGACGCGTATGGATACCGCATGTGCTTCATCATTACGTCTCTCGTGTACGTTGCGGGTCTGACCATGGACATGGTTCTCTT
GCCATTAACCAAGCATGCAGTTGAAAGATAA