Description :
From Genome Similarity Track
Location :
Scaffold_2071:2109- 3492
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2071-snap-gene-0.1Endo-1,3(4)-beta-glucanase

Sequence
1383 bases(100 bases per row)
GGACTACCGACGCACTCGACGCTGCCATGTACAGTGCCCACGATCGCGAGAGCCCATCGTCCAAGCTCGTGACCTGGAGCACATCTAGCGCGCGCGTCAT
GTTGACGGTTGCATAGTTGGCGTACAGTAGCGACAGCCACGTGTTCTTGAAATTGTTGTTGACAATGTCGGGAATCTTGCTCAGGATGGCGTCCCATTCT
TGGCTCACGAACGTAGCCGTGCGCACAAACTCGGTCACGGGTGTGATCGGGATCATCTGGATGCCGTGGACCGCGTAGTGTTCGCTGCTGAACCACGTCA
TGTACGCGACCTTGTTGTCCCACATGATGCCCGTGACTTTGTTGGAAATTATCGCCGGCGGATGCACGCGGTTGTCATCGGTCAGCAAGAAGTAGTTTTG
CGCGGCCCGTGTCGTGAGCTTGAGCATGAGCTGGCCCATGTTCAGCAGCGCAGCATTCCCGGTCGCCTTGCCAAACAGCGCCACAGCGTAGTGAAAGTTA
ACGTCCTCGGACACACTCTCTTCGTCCTTGCCGTCAAGCACGGCCGTCACGCCGTGCGAGTATGAGTGGCCGCGGAACCAGTCGAACTGGCGGAATCTTG
GGAAGCTCGTGTCGGCGCTAGACGGGTTGGCGACGTCGCGGATGAGGAACTTGGTCATGCGGTTGAGCTGGGCGAGCTTGGGCCACGCCGGGTCCAAGAA
ATTGACGATCGCCGACGCTGCGATCCAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTATTACCAAAATCGGCATTGAGGTCAT
TCTGGAGGATCCCGAGCGGACTGATGAGGCCGCGGTACACCGTGTCATAACTGAGCCGGTACGTCCACGAGTTGTCGAGCATCGGCGTGAGCGCGGTCTC
CAAATTATCCAGACACTTGCGCGTCAGCGGGACCGAGTCGGCGCCAGCGACGGCAACGTCGTTGGCCATGAGACACAAGTTGGCATACTTGTGGAGGGCC
TTGCCGGTAAAGTAGTACCCGCCATCGTGCGGCACGTTCCACGTCGCGTCAATGTCGGCGATCAAAGTCTCCTTGATCTTGTAGCTCACGACGAGCTCGG
TGCGAGGACTGCGTGGTGGGTAAAAGCTCACGGGCACATTCTGGGTCTCGGTGAAGCGAATCACCGGTGGGTTCGTGGTCGTCAGTACTCCTGTCATGGG
CCCACGGGTCGCCGAGTGCGCCGTCGAGCCACTCACTTCAACGGCGCTTGACCGGTCGAGCGTGTCCATGTGGTGCACCTGCAGGTAGTGGAAGAGTCCC
TTGGCGCAGTCGCCGCTTGTTTTGAGGTGGAACATGTACACGCTGTTGTCCTGGGCTTCGACATTGCTGCCTTCCAGCAGACA